Patent Search

 
 

Methods for identifying risk of breast cancer and treatments thereof

Abstrict

Provided herein are methods for identifying risk of breast cancer in a subject and/or a subject at risk of breast cancer, reagents and kits for carrying out the methods, methods for identifying candidate therapeutics for treating breast cancer, and therapeutic methods for treating breast cancer in a subject. These embodiments are based upon an analysis of polymorphic variations in nucleotide sequences within the human genome.

Claims

10. The method of claim 1, wherein one or more polymorphic variations are detected at one or more positions in linkage disequilibrium with a polymorphic variation at one or more of the positions in claim 1.

11. The method of claim 1, wherein detecting the presence or absence of the one or more polymorphic variations comprises: hybridizing an oligonucleotide to the nucleic acid sample, wherein the oligonucleotide is complementary to a nucleotide sequence in the nucleic acid and hybridizes to a region adjacent to the polymorphic variation; extending the oligonucleotide in the presence of one or more nucleotides, yielding extension products; and detecting the presence or absence of a polymorphic variation in the extension products.

14. The method of claim 13, wherein the proximal polymorphic variation is within a region between about 5 kb 5' of the incident polymorphic variation and about 5 kb 3' of the incident polymorphic variation.

15. The method of claim 13, which further comprises determining whether the proximal polymorphic variation is at a position in linkage disequilibrium with the incident polymorphic variation.

16. The method of claim 13, which further comprises identifying a second polymorphic variation proximal to the identified proximal polymorphic variation associated with breast cancer and determining if the second proximal polymorphic variation is associated with breast cancer.

17. The method of claim 16, wherein the second proximal polymorphic variant is within a region between about 5 kb 5' of the incident polymorphic variation and about 5 kb 3' of the proximal polymorphic variation associated with breast cancer.

18. An isolated nucleic acid which comprises one or more polymorphic variations corresponding to a variation selected from the group consisting of a thymine at position 45003 of SEQ ID NO: 1, an adenine at position 47504 of SEQ ID NO: 1, an adenine at position 30965 of SEQ ID NO: 2, a cytosine at position 38865 of SEQ ID NO: 2, a thymine at position 39035 of SEQ ID NO: 2, a cytosine at position 39046 of SEQ ID NO: 2, a cytosine at position 34941 in SEQ ID NO: 4, a guanine at position 35629 in SEQ ID NO: 4 and an adenine at position 15761 of SEQ ID NO: 5.

19. An oligonucleotide comprising a nucleotide sequence complementary to a portion of the nucleotide sequence of claim 18, wherein the 3' end of the oligonucleotide is adjacent to a polymorphic variation.

20. A microarray comprising an isolated nucleic acid of claim 18 linked to a solid support.

21. A method of genotyping a nucleic acid which comprises determining the nucleotide at one or more positions corresponding to a position selected from the group consisting of position 45003 of SEQ ID NO: 1, position 47504 of SEQ ID NO: 1, position 30965 of SEQ ID NO: 2, position 38865 of SEQ ID NO: 2, position 39035 of SEQ ID NO: 2, position 39046 of SEQ ID NO: 2, position 34941 in SEQ ID NO: 4, position 35629 in SEQ ID NO: 4 and position 15761 of SEQ ID NO: 5 in a nucleic acid.

42. The method of claim 41, wherein the breast cancer detection procedure is selected from the group consisting of a mammography, an early mammography program, a frequent mammography program, a biopsy procedure, a breast biopsy and biopsy from another tissue, a breast ultrasound and optionally ultrasound analysis of another tissue, breast magnetic resonance imaging (MRI) and optionally MRI analysis of another tissue, electrical impedance (T-scan) analysis of breast and optionally of another tissue, ductal lavage, nuclear medicine analysis (e.g., scintimammography), BRCA1 and/or BRCA2 sequence analysis results, thermal imaging of the breast and optionally of another tissue, and a combination of the foregoing.

43. The method of claim 41, wherein the breast cancer prevention procedure is selected from the group consisting of one or more selective hormone receptor modulators, one or more compositions that prevent production of hormones, one or more hormonal treatments, one or more biologic response modifiers, surgery, and drugs that delay or halt metastasis.

44. The method of claim 43, wherein the selective hormone receptor modulator is selected from the group consisting of tamoxifen, reloxifene, and toremifene; the composition that prevents production of hormones is an aramotase inhibitor selected from the group consisting of exemestane, letrozole, anastrozol, groserelin, and megestrol; the hormonal treatment is selected from the group consisting of goserelin acetate and fulvestrant; the biologic response modifier is an antibody that specifically binds herceptin/HER2; the surgery is selected from the group consisting of lumpectomy and mastectomy; and the drug that delays or halts metastasis is pamidronate disodium.

45. A composition comprising a breast cancer cell and an antibody that specifically binds to a protein, polypeptide or peptide encoded by a nucleotide sequence identical to or 90% or more identical to a nucleotide sequence in SEQ ID NO: 1-17, wherein the protein, polypeptide or peptide comprises a leucine corresponding to the amino acid at position 359 in SEQ ID NO: 23, a leucine corresponding to the amino acid at position 378 in SEQ ID NO: 23, an alanine corresponding to the amino acid at position 857 in SEQ ID NO: 23, an alanine corresponding to the amino acid at position 902 in SEQ ID NO: 23, a proline corresponding to the amino acid at position 352 in SEQ ID NO: 20, an alanine corresponding to the amino acid at position 348 in SEQ ID NO: 20 or a glycine corresponding to the amino acid at position 794 in SEQ ID NO: 24.

Description

RELATED PATENT APPLICATIONS

[0001] This patent application claims the benefit of provisional patent application No. 60/490,234 filed Jul. 24, 2003, having attorney docket number 524593004101. This patent application is a continuation in part of U.S. patent application Ser. No. 10/723,681 filed on Nov. 25, 2003, entitled "Methods for identifying risk of breast cancer and treatments thereof," naming Richard B. Roth et al. as inventors, and having attorney docket no. 524592006900. U.S. patent application Ser. Nos. 10/723,670, 10/723,518, 10/722,939 and 10/723,683, having attorney docket numbers524592006700, 524592006800, 524592007100 and 524592007200, respectively, filed on Nov. 25, 2003, name Richard B. Roth et al. as inventors, and have the same title as U.S. patent application Ser. No. 10/723,681, are related. This patent application also claims the benefit of U.S. patent application No. 60/525,239 filed on Nov. 25, 2003, naming Matthew R. Nelson as an inventor, entitled "Disease risk prediction with associated single nucleotide polymorphisms," and having attorney docket number 524593006400. Each of these patent applications is hereby incorporated herein by reference in its entirety, including all drawings, cited publications and documents

FIELD OF THE INVENTION

[0002] The invention relates to genetic methods for identifying risk of breast cancer and treatments that specifically target the disease.

BACKGROUND

[0003] Breast cancer is the third most common cancer, and the most common cancer in women, as well as a cause of disability, psychological trauma, and economic loss. Breast cancer is the second most common cause of cancer death in women in the United States, in particular for women between the ages of 15 and 54, and the leading cause of cancer-related death (Forbes, Seminars in Oncology, vol. 24 (1), Suppl 1, 1997: pp. S1-20-S1-35). Indirect effects of the disease also contribute to the mortality from breast cancer including consequences of advanced disease, such as metastases to the bone or brain. Complications arising from bone marrow suppression, radiation fibrosis and neutropenic sepsis, collateral effects from therapeutic interventions, such as surgery, radiation, chemotherapy, or bone marrow transplantation-also contribute to the morbidity and mortality from this disease.

[0004] While the pathogenesis of breast cancer is unclear, transformation of normal breast epithelium to a malignant phenotype may be the result of genetic factors, especially in women under thirty (Miki, et al., Science, 266: 66-71 (1994)). However, it is likely that other, non-genetic factors also have a significant effect on the etiology of the disease. Regardless of its origin, breast cancer morbidity increases significantly if it is not detected early in its progression. Thus, considerable efforts have focused on the elucidation of early cellular events surrounding transformation in breast tissue. Such efforts have led to the identification of several potential breast cancer markers. For example, alleles of the BRCA1 and BRCA2 genes have been linked to hereditary and early-onset breast cancer (Wooster, et al., Science, 265: 2088-2090 (1994)). However, BRCA1 is limited as a cancer marker because BRCA1 mutations fail to account for the majority of breast cancers (Ford, et al., British J. Cancer, 72: 805-812 (1995)). Similarly, the BRCA2 gene, which has been linked to forms of hereditary breast cancer, accounts for only a small portion of total breast cancer cases.

SUMMARY

[0005] It has been discovered that certain polymorphic variations in human genomic DNA are associated with the occurrence of breast cancer. In particular, polymorphic variants in loci containing ICAM, MAPK10, KIAA0861, NUMA1/FLJ20625/LOC220074 (hereafter referred to as "NUMA1"), HT014/LOC148902/LYPLA2/GALE (hereafter refered to as "GALE"), DPF3 and LOC145197 regions in human genomic DNA have been associated with risk of breast cancer.

[0006] Thus, featured herein are methods for identifying a subject at risk of breast cancer and/or a risk of breast cancer in a subject, which comprises detecting the presence or absence of one or more polymorphic variations accociated with breast cancer in genomic regions described herein in a human nucleic acid sample. In an embodiment, two or more polymorphic variations are detected in two or more regions selected from the group consisting of ICAM, MAK10, KIAA0861, NUMA1, GALE, DPF3 and LOC145197. In certain embodiments, 3 or more, or 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 or more polymorphic variants are detected. In specific embodiments, the group of polymorphic variants detected comprise or consist of polymorphic variants in ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 and/or LOC145197, such as position 44247 in SEQ ID NO: 1 (ICAM), position 36424 in SEQ ID NO: 2 (MAPK10), position 48563 in SEQ ID NO: 3 (KIAA0861), position 49002 in SEQ ID NO: 4 (NUMA1) and position 174 in SEQ ID NO: 5 (GALE), for example.

[0007] Also featured are nucleic acids that include one or more polymorphic variations associated with the occurrence of breast cancer, as well as polypeptides encoded by these nucleic acids. Further, provided is a method for identifying a subject at risk of breast cancer and then prescribing to the subject a breast cancer detection procedure, prevention procedure and/or a treatment procedure. In addition, provided are methods for identifying candidate therapeutic molecules for treating breast cancer and related disorders, as well as methods for treating breast cancer in a subject by diagnosing breast cancer in the subject and treating the subject with a suitable treatment, such as administering a therapeutic molecule.

[0008] Also provided are compositions comprising a breast cancer cell and/or ICAM, AAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleic acid with a RNAi, siRNA, antisense DNA or RNA, or ribozyme nucleic acid designed from a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleotide sequence. In an embodiment, the nucleic acid is designed from a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleotide sequence that includes one or more breast cancer associated polymorphic variations, and in some instances, specifically interacts with such a nucleotide sequence. Further, provided are arrays of nucleic acids bound to a solid surface, in which one or more nucleic acid molecules of the array have a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleotide sequence, or a fragment or substantially identical nucleic acid thereof, or a complementary nucleic acid of the foregoing. Featured also are compositions comprising a breast cancer cell and/or a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide, with an antibody that specifically binds to the polypeptide. In an embodiment, the antibody specifically binds to an epitope in the polypeptide that includes a non-synonymous amino acid modification associated with breast cancer (e.g., results in an amino acid substitution in the encoded polypeptide associated with breast cancer). In certain embodiments, the antibody specifically binds to an epitope that comprises a proline at amino acid position 352, an alanine at amino acid position 348, or a glycine at amino acid position 241 in an ICAM5 polypeptide.

BRIEF DESCRIPTION OF THE FIGURES

[0009] FIGS. 1A-1G show proximal SNPs in ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 and LOC145197 regions of genomic DNA, respectively. The position of each SNP on the chromosome is shown on the x-axis and the y-axis provides the negative logarithm of the p-value comparing the estimated allele to that of the control group. Also shown in the figure are exons and introns of the genes in the approximate chromosomal positions.

[0010] FIGS. 2A-2D show results of an odds-ratio meta analysis for ICAM, MAPK10, KIkA0861 NUMA1 regions.

[0011] FIG. 3 shows effects of ICAM-directed siRNA on cancer cell proliferation.

DETAILED DESCRIPTION

[0012] It has been discovered that polymorphic variations in the ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 and LOC145197 regions described herein are associated with an increased risk of breast cancer.

[0013] All ICAM proteins are type I transmembrane glycoproteins, contain 2-9 immunoglobulin-like C2-type domains, and bind to the leukocyte adhesion LFA-1 protein. The proteins are members of the intercellular adhesion molecule (ICAM) family. The gene ICAM1 (intercellular adhesion molecule-1) is also known as human rhinovirus receptor, BB2, CD54. and cell surface glycoprotein P3.58. ICAM1 has been mapped to chromosomal position 19p13.3-p13.2. ICAM1 (CD54) typically is expressed on endothelial cells and cells of the immune system. ICAM1 binds to integrins of type CD11a/CD 18, or CD11b/CD18. ICAM1 is also exploited by Rhinovirus as a receptor.

[0014] The gene ICAM4 (intercellular adhesion molecule 4) is also known as the Landsteiner-Wiener blood group or LW. ICAM4 has been mapped to 19p13.2-cen. The protein encoded by this gene is a member of the intercellular adhesion molecule (ICAM) family. A glutamine to arginine polymorphism in this protein is responsible for the Landsteiner-Wiener blood group system (GLN=WB(A); ARG=WB(B). This gene consists of 3 exons and alternative splicing generates 2 transcript variants.

[0015] The gene ICAM5 (intercellular adhesion molecule 5) is also known as telencephalin. ICAM5 has been mapped to 19p13.2. The protein encoded by the gene is expressed on the surface of telencephalic neurons and displays two types of adhesion activity, homophilic binding between neurons and heterophilic binding between neurons and leukocytes. It may be a critical component in neuron-microglial cell interactions in the course of normal development or as part of neurodegenerative diseases.

[0016] The gene MAPK10 also is known as JNK3, JNK3A, PRKM10, p493F12, FLJ12099, p54bSAPK MAP kinase, c-Jun kinase 3, JNK3 alpha protein kinase, c-Jun N-terminal kinase 3, stress activated protein kinase JNK3, stress activated protein kinase beta. MAPK10 has been mapped to chromosomal position 4q22.1-q23. The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This protein is a neuronal-specific form of c-Jun N-terminal kinases (JNKs). Through its phosphorylation and nuclear localization, this kinase plays regulatory roles in the signaling pathways during neuronal apoptosis. Beta-arrestin 2, a receptor-regulated MAP kinase scaffold protein, is found to interact with, and stimulate the phosphorylation of this kinase by MAP kinase kinase 4 (MKK4). Cyclin-dependent kinase 5 can phosphorylate, and inhibit the activity of this kinase, which may be important in preventing neuronal apoptosis. Four alternatively spliced transcript variants encoding distinct isoforms have been reported.

[0017] The gene KIAA0861 is a Rho family guanine-nucleotide exchange factor. KIAA0861 has been mapped to chromosomal position 3q27.3. KIAA0861 is a Rho family nucleotide exchange factor homolog that modulates the activity of Rho family GTPases, which control numerous cell functions, including cell growth, adhesion, movement and shape. RhoC GTPase is overexpressed in invasive (inflammatory) breast cancers.

[0018] The gene FLJ20625 has been mapped to chromosomal position 11q13.3. The gene encoding LOC220074 also is known as Hypothetical 55.1 kDa protein F09G8.5 in chromosome III and has been mapped to chromosomal position 11q13.3.

[0019] The gene HT014 has been mapped to chromosomal position 1p36.11. The gene LYPLA2 (lysophospholipase II) also is known as APT-2, DJ886K2.4 and acyl-protein thioesterase and has been mapped to chromosomal position 1p36.12-p35.1. Lysophospholipases are enzymes that act on biological membranes to regulate the multifunctional lysophospholipids. There are alternatively spliced transcript variants described for this gene but the full length nature is not known yet.

[0020] The gene GALE (galactose-4-epimerase, UDP-) also is known as galactowaldenase UDP galactose4-epimerase and has been mapped to chromosomal position 1 p36-p35. This gene encodes UDP-galactose-4-epimera- se which catalyzes 2 distinct but analogous reactions: the epimerization of UDP-glucose to UDP-galactose, and the epimerization of UDP-N-acetylglucosamine to UDP-N-acetylgalactosamine. The bifunctional nature of the enzyme has the important metabolic consequence that mutant cells (or individuals) are dependent not only on exogenous galactose, but also on exogenous N-acetylgalactosamine for necessary precursor for the synthesis of glycoproteins and glycolipids. The missense mutations in the GALE gene result in the epimerase-deficiency galactosemia.

[0021] The gene DPF3 (D4, zinc and double PHD fingers, family 3) also is known as CERD4, cer-d4, FLJ14079, and 2810403B03Rik. DPF3 is a Rho family guanine-nucleotide exchange factor. DPF3 has been mapped to chromosomal position 14q24.3-q31.1.

[0022] Breast Cancer and Sample Selection

[0023] Breast cancer is typically described as the uncontrolled growth of malignant breast tissue. Breast cancers arise most commonly in the lining of the milk ducts of the breast (ductal carcinoma), or in the lobules where breast milk is produced (lobular carcinoma). Other forms of breast cancer include Inflammatory Breast Cancer and Recurrent Breast Cancer. Inflammatory breast cancer is a rare, but very serious, aggressive type of breast cancer. The breast may look red and feel warm with ridges, welts, or hives on the breast; or the skin may look wrinkled. It is sometimes misdiagnosed as a simple infection. Recurrent disease means that the cancer has come back after it has been treated. It may come back in the breast, in the soft tissues of the chest (the chest wall), or in another part of the body.

[0024] As used herein, the term "breast cancer" refers to a condition characterized by anomalous rapid proliferation of abnormal cells in one or both breasts of a subject. The abnormal cells often are referred to as "neoplastic cells," which are transformed cells that can form a solid tumor. The term "tumor" refers to an abnormal mass or population of cells (i.e. two or more cells) that result from excessive or abnormal cell division, whether malignant or benign, and pre-cancerous and cancerous cells. Malignant tumors are distinguished from benign growths or tumors in that, in addition to uncontrolled cellular proliferation, they can invade surrounding tissues and can metastasize. In breast cancer, neoplastic cells may be identified in one or both breasts only and not in another tissue or organ, in one or both breasts and one or more adjacent tissues or organs (e.g. lymph node), or in a breast and one or more non-adjacent tissues or organs to which the breast cancer cells have metastasized.

[0025] The term "invasion" as used herein refers to the spread of cancerous cells to adjacent surrounding tissues. The term "invasion" often is used synonymously with the term "metastasis," which as used herein refers to a process in which cancer cells travel from one organ or tissue to another non-adjacent organ or tissue. Cancer cells in the breast(s) can spread to tissues and organs of a subject, and conversely, cancer cells from other organs or tissue can invade or metastasize to a breast. Cancerous cells from the breast(s) may invade or metastasize to any other organ or tissue of the body. Breast cancer cells often invade lymph node cells and/or metastasize to the liver, brain and/or bone and spread cancer in these tissues and organs. Breast cancers can spread to other organs and tissues and cause lung cancer, prostate cancer, colon cancer, ovarian cancer, cervical cancer, gastrointestinal cancer, pancreatic cancer, glioblastoma, bladder cancer, hepatoma, colorectal cancer, uterine cervical cancer, endometrial carcinoma, salivary gland carcinoma, kidney cancer, vulval cancer, thyroid cancer, hepatic carcinoma, skin cancer, melanoma, ovarian cancer, neuroblastoma, myeloma, various types of head and neck cancer, acute lymphoblastic leukemia, acute myeloid leukemia, Ewing sarcoma and peripheral neuroepithelioma, and other carcinomas, lymphomas, blastomas, sarcomas, and leukemias.

[0026] Breast cancers arise most commonly in the lining of the milk ducts of the breast (ductal carcinoma), or in the lobules where breast milk is produced (lobular carcinoma). Other forms of breast cancer include Inflammatory Breast Cancer and Recurrent Breast Cancer. Inflammatory Breast Cancer is a rare, but very serious, aggressive type of breast cancer. The breast may look red and feel warm with ridges, welts, or hives on the breast; or the skin may look wrinkled. It is sometimes misdiagnosed as a simple infection. Recurrent disease means that the cancer has come back after it has been treated. It may come back in the breast, in the soft tissues of the chest (the chest wall), or in another part of the body. As used herein, the term "breast cancer" may include both Inflammatory Breast Cancer and Recurrent Breast Cancer.

[0027] In an effort to detect breast cancer as early as possible, regular physical exams and screening mammograms often are prescribed and conducted. A diagnostic mammogram often is performed to evaluate a breast complaint or abnormality detected by physical exam or routine screening mammography. If an abnormality seen with diagnostic mammography is suspicious, additional breast imaging (with exams such as ultrasound) or a biopsy may be ordered. A biopsy followed by pathological (microscopic) analysis is a definitive way to determine whether a subject has breast cancer. Excised breast cancer samples often are subjected to the following analyses: diagnosis of the breast tumor and confirmation of its malignancy; maximum tumor thickness; assessment of completeness of excision of invasive and in situ components and microscopic measurements of the shortest extent of clearance; level of invasion; presence and extent of regression; presence and extent of ulceration; histological type and special variants; pre-existing lesion; mitotic rate; vascular invasion; neurotropism; cell type; tumor lymphocyte infiltration; and growth phase.

[0028] The stage of a breast cancer can be classified as a range of stages from Stage 0 to Stage IV based on its size and the extent to which it has spread. The following table summarizes the stages:

1TABLE A Metastasis Stage Tumor Size Lymph Node Involvement (Spread) I Less than 2 cm No No II Between 2-5 cm No or in same side of breast No III More than 5 cm Yes, on same side of breast No IV Not applicable Not applicable Yes

[0029] Stage 0 cancer is a contained cancer that has not spread beyond the breast ductal system. Fifteen to twenty percent of breast cancers detected by clinical examinations or testing are in Stage 0 (the earliest form of breast cancer). Two types of Stage 0 cancer are lobular carcinoma in situ (LCIS) and ductal carcinoma in situ (DCIS). LCIS indicates high risk for breast cancer. Many physicians do not classify LCIS as a malignancy and often encounter LCIS by chance on breast biopsy while investigating another area of concern. While the microscopic features of LCIS are abnormal and are similar to malignancy, LCIS does not behave as a cancer (and therefore is not treated as a cancer). LCIS is merely a marker for a significantly increased risk of cancer anywhere in the breast. However, bilateral simple mastectomy may be occasionally performed if LCIS patients have a strong family history of breast cancer. In DCIS the cancer cells are confined to milk ducts in the breast and have not spread into the fatty breast tissue or to any other part of the body (such as the lymph nodes). DCIS may be detected on mammogram as tiny specks of calcium (known as microcalcifications) 80% of the time. Less commonly DCIS can present itself as a mass with calcifications (15% of the time); and even less likely as a mass without calcifications (<5% of the time). A breast biopsy is used to confirm DCIS. A standard DCIS treatment is breast-conserving therapy (BCT), which is lumpectomy followed by radiation treatment or mastectomy. To date, DCIS patients have chosen equally among lumpectomy and mastectomy as their treatment option, though specific cases may sometimes favor lumpectomy over mastectomy or vice versa.

[0030] In Stage I, the primary cancer is 2 cm or less in diameter and has not spread to the lymph nodes. In Stage IIA, the primary tumor is between 2 and 5 cm in diameter and has not spread to the lymph nodes. In Stage IIIB, the primary tumor is between 2 and 5 cm in diameter and has spread to the axillary (underarm) lymph nodes; or the primary tumor is over 5 cm and has not spread to the lymph nodes. In Stage 111A, the primary breast cancer of any kind that has spread to the axillary (underarm) lymph nodes and to axillary tissues. In Stage IIIB, the primary breast cancer is any size, has attached itself to the chest wall, and has spread to the pectoral (chest) lymph nodes. In Stage IV, the primary cancer has spread out of the breast to other parts of the body (such as bone, lung, liver, brain). The treatment of Stage IV breast cancer focuses on extending survival time and relieving symptoms.

[0031] Based in part upon selection criteria set forth above, individuals having breast cancer can be selected for genetic studies. Also, individuals having no history of cancer or breast cancer often are selected for genetic studies. Other selection criteria can include: a tissue or fluid sample is derived from an individual characterized as Caucasian; the sample was derived from an individual of German paternal and maternal descent; the database included relevant phenotype information for the individual; case samples were derived from individuals diagnosed with breast cancer; control samples were derived from individuals free of cancer and no family history of breast cancer; and sufficient genomic DNA was extracted from each blood sample for all allelotyping and genotyping reactions performed during the study. Phenotype information included pre- or post-menopausal, familial predisposition, country or origin of mother and father, diagnosis with breast cancer (date of primary diagnosis, age of individual as of primary diagnosis, grade or stage of development, occurrence of metastases, e.g., lymph node metastases, organ metastases), condition of body tissue (skin tissue, breast tissue, ovary tissue, peritoneum tissue and myometrium), method of treatment (surgery, chemotherapy, hormone therapy, radiation therapy).

[0032] Provided herein is a set of blood samples and a set of corresponding nucleic acid samples isolated from the blood samples, where the blood samples are donated from individuals diagnosed with breast cancer. The sample set often includes blood samples or nucleic acid samples from 100 or more, 150 or more, or 200 or more individuals having breast cancer, and sometimes from 250 or more, 300 or more, 400 or more, or 500 or more individuals. The individuals can have parents from any place of origin, and in an embodiment, the set of samples are extracted from individuals of German paternal and German maternal ancestry. The samples in each set may be selected based upon five or more criteria and/or phenotypes set forth above.

[0033] Polymorphic Variants Associated with Breast Cancer

[0034] A genetic analysis provided herein linked breast cancer with polymorphic variants in the ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 and LOC145197 regions of the human genome disclosed herein. As used herein, the term "polymorphic site" refers to a region in a nucleic acid at which two or more alternative nucleotide sequences are observed in a significant number of nucleic acid samples from a population of individuals. A polymorphic site may be a nucleotide sequence of two or more nucleotides, an inserted nucleotide or nucleotide sequence, a deleted nucleotide or nucleotide sequence, or a microsatellite, for example. A polymorphic site that is two or more nucleotides in length may be 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more, 20 or more, 30 or more, 50 or more, 75 or more, 100 or more, 500 or more, or about 1000 nucleotides in length, where all or some of the nucleotide sequences differ within the region. A polymorphic site is often one nucleotide in length, which is referred to herein as a "single nucleotide polymorphism" or a "SNP."

[0035] Where there are two, three, or four alternative nucleotide sequences at a polymorphic site, each nucleotide sequence is referred to as a "polymorphic variant" or "nucleic acid variant." Where two polymorphic variants exist, for example, the polymorphic variant represented in a minority of samples from a population is sometimes referred to as a "minor allele" and the polymorphic variant that is more prevalently represented is sometimes referred to as a "major allele." Many organisms possess a copy of each chromosome (e.g., humans), and those individuals who possess two major alleles or two minor alleles are often referred to as being "homozygous" with respect to the polymorphism, and those individuals who possess one major allele and one minor allele are normally referred to as being "heterozygous" with respect to the polymorphism. Individuals who are homozygous with respect to one allele are sometimes predisposed to a different phenotype as compared to individuals who are heterozygous or homozygous with respect to another allele.

[0036] Furthermore, a genotype or polymorphic variant may be expressed in terms of a "haplotype," which as used herein refers to two or more polymorphic variants occurring within genomic DNA in a group of individuals within a population. For example, two SNPs may exist within a gene where each SNP position includes a cytosine variation and an adenine variation. Certain individuals in a population may carry one allele (heterozygous) or two alleles (homozygous) having the gene with a cytosine at each SNP position. As the two cytosines corresponding to each SNP in the gene travel together on one or both alleles in these individuals, the individuals can be characterized as having a cytosine/cytosine haplotype with respect to the two SNPs in the gene.

[0037] As used herein, the term "phenotype" refers to a trait which can be compared between individuals, such as presence or absence of a condition, a visually observable difference in appearance between individuals, metabolic variations, physiological variations, variations in the function of biological molecules, and the like. An example of a phenotype is occurrence of breast cancer.

[0038] Researchers sometimes report a polymorphic variant in a database without determining whether the variant is represented in a significant fraction of a population. Because a subset of these reported polymorphic variants are not represented in a statistically significant portion of the population, some of them are sequencing errors and/or not biologically relevant. Thus, it is often not known whether a reported polymorphic variant is statistically significant or biologically relevant until the presence of the variant is detected in a population of individuals and the frequency of the variant is determined. Methods for detecting a polymorphic variant in a population are described herein, specifically in Example 2. A polymorphic variant is statistically significant and often biologically relevant if it is represented in 5% or more of a population, sometimes 10% or more, 15% or more, or 20% or more of a population, and often 25% or more, 30% or more, 35% or more, 40% or more, 45% or more, or 50% or more of a population.

[0039] A polymorphic variant may be detected on either or both strands of a double-stranded nucleic acid. For example, a thymine at a particular position in SEQ ID NO: 1 can be reported as an adenine from the complementary strand. Also, a polymorphic variant may be located within an intron or exon of a gene or within a portion of a regulatory region such as a promoter, a 5' untranslated region (UTR), a 3' UTR, and in DNA (e.g., genomic DNA (gDNA) and complementary DNA (cDNA)), RNA (e.g., mRNA, tRNA, and rRNA), or a polypeptide. Polymorphic variations may or may not result in detectable differences in gene expression, polypeptide structure, or polypeptide function.

[0040] In the genetic analysis that associated breast cancer with the polymorphic variants described hereafter, samples from individuals having breast cancer and individuals not having cancer were allelotyped and genotyped. The term "genotyped" as used herein refers to a process for determining a genotype of one or more individuals, where a "genotype" is a representation of one or more polymorphic variants in a population. Genotypes may be expressed in terms of a "haplotype," which as used herein refers to two or more polymorphic variants occurring within genomic DNA in a group of individuals within a population. For example, two SNPs may exist within a gene where each SNP position includes a cytosine variation and an adenine variation. Certain individuals in a population may carry one allele (heterozygous) or two alleles (homozygous) having the gene with a cytosine at each SNP position. As the two cytosines corresponding to each SNP in the gene travel together on one or both alleles in these individuals, the individuals can be characterized as having a cytosine/cytosine haplotype with respect to the two SNPs in the gene.

[0041] It was determined that polymorphic variations associated with an increased risk of breast cancer existed in ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 and LOC145197 nucleotide sequences. Polymorphic variants in and around the ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 and LOC145197 loci were tested for association with breast cancer. In the ICAM locus, these included polymorphic variants at positions selected from the group consisting of rs2884487, rs2358580, rs2304236, rs1059840, rs1059843, rs11115, rs1059849, rs1059855, rs5030386, rs5030339, rs5030387, rs5030388, rs1799766, rs5030389, rs5490, rs11575070, rs5030340, rs5030390, rs5030391, rs3093035, rs11667983, rs5030341, rs5030342, rs5030343, rs5030344, rs5030347, rs5030348, rs5030349, rs5030350, rs5030351, rs5491, rs5030352, rs5030353, rs10420063, rs11879117, rs5030354, rs5030355, rs281428, rs5030358, rs5030359, rs5030392, rs5030393, rs5030360, rs5030394, rs281429, rs5030361, rs5030362, rs281430, rs281431, rs5030395, rs5827095, rs281432, rs5030364, rs5030365, rs5030368, rs5030369, rs3073809, rs2358581, rs7258215, rs5030371, rs5030372, rs281433, rs5030374, rs5030375, rs5030397, rs281434, rs12462944, rs5030398, rs5030378, rs12459133, rs5030399, rs5492, rs1800019, rs1799969, rs5493, rs5030381, rs5494, rs3093033, rs5495, rs1801714, rs2071441, rs5496, rs5497, rs5030382, rs5030400, rs2071440, rs5499, rs3093032, rs1057981, rs5500, rs5501, rs5030383, rs281436, rs923366, rs281437, rs3093030, rs5030384, rs5030385, rs3810159, rs281438, rs3093029, rs2735442, rs2569693, rs281439, rs281440, rs2569694, rs11575073, rs2569695, rs2075741, rs11575074, rs2569696, rs2735439, rs2569697, rs2075742, rs2569698, rs11669397, rs901886, rs885742, rs2569699, rs11549918, rs2569700, rs2228615, rs2569701, rs2569702, rs2735440, rs2569703, rs10418913, rs1056536, rs2569704, rs11673661, rs10402760, rs2569706, rs2569707, rs2436545, rs2436546, rs2916060, rs2916059, rs2916058, rs2569708, rs735747, rs885743, rs710845, rs2569709, rs2569710, rs2569711, rs2569712, rs12610026, rs4804129, rs12150978, rs439843, rs892188, rs2291473, rs281416, rs281417, rs882589, rs1048941, rs281418, rs430092, rs368835, rs2358583, rs378395, rs395782, rs1045384, rs281427, rs3745264, rs281426, rs281425, rs281424, rs281423, rs281422, rs281420, rs3745263, rs3745262, rs3745261, rs3181049, rs281412, rs3181048, rs2230399, rs2278442, rs3181047, rs3181046, rs2304237, rs281413, rs1058154, rs3176769, rs2304238, rs2304239, rs2304240, rs3176768, rs3176767, rs3176766, rs281414, rs281415, position 45003 of SEQ ID NO: 1, and position 47504 of SEQ ID NO: 1. Polymorphic variants at the following positions in particular were associated with an increased risk of breast cancer: rs11115, rs1059849, rs5030391, rs5030382, rs3093030, rs2569693, rs2075741, rs901886, rs11549918, rs2228615, rs2569702, rs2569703, rs10402760, rs710845, rs892188, and rs281426. At these positions in SEQ ID NO: 1, a cytosine at position 11942, an adenine at position 12054, a guanine at position 24037, an adenine at position 37083, a cytosine at position 38803, a cytosine at position 41304, a guanine at position 42498, a thymine at position 43531, a cytosine at position 44338, a guanine at position 44768, a thymine at position 45347, a cytosine at position 45627, a thymine at position 47265, a cytosine at position 48569, a cytosine at position 51193, a guanine at position 72451, in particular were associated with risk of breast cancer. Also, a proline at amino acid position 352 or an alanine at amino acid position 348 in SEQ ID NO: 15 were in particular associated with an increased risk of breast cancer.

[0042] In the MAPK10 locus, these included polymorphic variants at positions selected from the group consisting of rs2575681, rs2575680, rs2589505, rs2589504, rs2164538, rs2575679, rs10305, rs2869408, rs2904086, rs934648, rs2589511, rs2060589, rs2164537, rs2575678, rs2575677, rs2589510, rs2589509, rs2164536, rs2164535, rs1946734, rs2589525, rs2589523, rs3755970, rs2575675, rs1202, rs1201, rs2589516, rs2575674, rs2589515, rs3733367, rs958, rs2589506, rs1436524, rs2575672, rs2589518, rs3775164, rs2589514, rs3775166, rs3775167, rs3822035, rs3775168, rs3775169, rs2043650, rs2043649, rs3775170, rs1541998, rs2282599, rs2282598, rs2282597, rs3775171, rs3775172, rs3775173, rs3775174, rs1469870, rs1436522, rs1946733, rs983362, rs3755971, rs3822036, rs3775175, rs1436525, rs3822037, rs3775176, rs993593, rs1436527, rs1436529, rs3775180, rs3775181, rs3775182, rs3775183, rs3775184, rs733245, rs3775185, rs1561154, rs3775186, rs3775187, rs1010778, rs2282596, rs2282595, rs2118044, rs1469869, position 21751 of SEQ ID NO: 2, position 30965 of SEQ ID NO: 2, position 36838 of SEQ ID NO: 2, position 36889 of SEQ ID NO: 2, position 38639 of SEQ ID NO: 2, position 38865 of SEQ ID NO: 2, position 38885 of SEQ ID NO: 2, position 38943 of SEQ ID NO: 2, position 39035 of SEQ ID NO: 2, position 39046 of SEQ ID NO: 2, and position 110704 of SEQ ID NO: 2. Polymorphic variants at the following positions in particular were associated with an increased risk of breast cancer: rs2575677, rs2575674, rs1436524, rs2575672, rs2589518, rs2589514, rs3775166, MAPK10-AB, rs3775168, rs2043650, rs2043649, rs1541998, position 38865 of SEQ ID NO: 2, position 39035 of SEQ ID NO: 2, position 39046 of SEQ ID NO: 2, rs1469870, and rs3775176. At these positions in SEQ ID NO: 2, a guanine at position 13918, an adenine at position 23841, an adenine at position 26072, a thymine at position 26376, an adenine at position 26614, an adenine at position 26827, a cytosine at position 27084, an adenine at position 30965, an adenine at position 32979, an adenine at position 35142, a thymine at position 35237, a cytosine at position 36439, a thymine at position 38865, a thymine at position 39035, a cytosine at position 39046, a cytosine at position 46191, and an adenine at position 62587, in particular were associated with risk of breast cancer.

[0043] In the KIAA0861 locus, these included polymorphic variants at positions selected from the group consisting of rs3811728, rs3811729, rs602646, rs488277, rs1629673, rs670232, rs575326, rs575386, rs684846, rs471365, rs496251, rs831246, rs831247, rs512071, rs1502761, rs681516, rs683302, rs619424, rs620722, rs529055, rs664010, rs678454, rs2653845, rs472795, rs507079, rs534333, rs535298, rs536213, rs831245, rs639690, rs684174, rs571761, rs1983421, rs4630966, rs2314415, rs6788196, rs2103062, rs9827084, rs9864865, rs6804951, rs6770548, rs1403452, rs7609994, rs9838250, rs9863404, rs903950, rs6787284, rs2017340, rs2001449, rs1317288, rs7635891, rs10704581, rs11371910, rs10937118, rs7642053, rs3821522, rs2029926, rs1390831, rs7643890, rs11925606, rs9826325, rs6800429, rs6803368, rs1353566, rs2272115, rs2272116, rs3732603, rs940055, rs2314730, rs2030578, rs2049280, rs3732602, rs2293203, rs7639705, and position 13507 of SEQ ID NO: 3. Polymorphic variants at the following positions in particular were associated with an increased risk of breast cancer: rs4630966, rs9827084, rs9864865, rs6804951, rs6770548, rs1403452, and rs2001449. At these positions in SEQ ID NO: 3, a cytosine at position 41716, a guanine at position 44775, a guanine at position 44962, a cytosine at position 45317, a guanine at position 45712, a thymine at position 45941, and a cytosine at position 48849, in particular were associated with risk of breast cancer. Also, an alanine at amino acid position 819 in SEQ ID NO: 22 (or position 902 in SEQ ID NO: 23) was in particular associated with an increased risk of breast cancer.

[0044] In the NUMA1 locus, these included polymorphic variants at positions corresponding to these selected from the group consisting of rs4945392, rs7938496, rs7926550, rs7945374, rs7949480, rs7102523, rs7121260, rs7131230, rs7128317, rs2276385, rs2276384, rs2276383, rs1892921, rs1892920, rs7942626, rs7124429, rs7114081, rs7125718, rs1055452, rs3829215, rs1541306, rs3814722, rs1939240, rs5743655, rs5743656, rs5743657, rs3814721, rs5743658, rs5743659, rs5743660, rs5743661, rs5743662, rs2298455, rs5743664, rs5743665, rs5743667, rs5743668, rs5743669, rs1573503, rs5743670, rs5743671, rs1892919, rs5743672, rs2735786, rs5743673, rs5743674, rs1062452, rs5743675, rs5743676, rs760246, rs11345794, rs5743677, rs5743678, rs14537, rs3168177, rs5743679, rs1541304, rs1053725, rs5743680, rs949324, rs949323, rs5743681, rs5743682, rs5743683, rs5743684, rs5743685, rs2845857, rs2852365, rs11538641, rs11538639, rs11235417, rs11538644, rs11538643, rs2845858, rs2155146, rs2852364, rs2845859, rs2845860, rs11538642, rs7949430, rs7938674, rs2735787, rs11538640, rs10736784, rs10736785, rs11826059, rs2503, rs2155145, rs4477459, position 26334 of SEQ ID NO: 4, rs5019605, rs5019604, rs5019603, rs3793941, rs11235418, rs3793940, rs2032353, rs3934448, rs7951267, rs1053603, rs1053602, rs11235419, rs1053601, rs3750913, rs3750912, rs1053600, rs1057992, rs2298789, rs10898813, position 34941 of SEQ ID NO: 4, rs949325, position 35629 of SEQ ID NO: 4, rs949326, rs2298456, rs7949845, rs7949989, rs1573500, rs4945411, rs11235422, rs10128658, rs2298457, rs3838779, rs1573501, rs11235424, rs10898814, rs7930142, rs7930544, rs7930721, rs7930722, rs6592456, rs11235425, rs6592457, rs10898815, rs11235426, rs10898816, rs1939247, rs1939246, rs1939245, rs1939244, rs1939243, rs4245463, rs4944258, rs7926751, rs12282917, rs12282918, rs7937582, rs10898817, rs7480015, rs7123992, rs1573502, rs7127865, rs4945426, rs11235428, rs7122489, rs1894003, rs1548348, rs1892923, rs5792570, rs7115200, rs4945430, rs11235429, rs1939242, rs9666346, rs7101553, rs7124000, rs12291664, rs12291778, rs12291781, rs12291787, rs12291788, rs12291833, rs10793016, rs5792571, rs12293529, rs4338555, rs11235431, rs6592458, rs4945434, rs4945435, rs11307657, rs5792573, rs1894004, rs12276164, rs4378421, rs7116495, rs7101701, rs10736786, rs11608165, rs645603, rs661290, rs7122209, rs12417471, rs541228, rs12273666, rs2511074, rs3018311, rs3018289, rs679926, rs567026, rs564294, rs678193, rs677279, rs560777, rs676721, rs7106529, rs11602304, rs585228, rs578957, rs7110215, rs3133233, rs3133230, rs12576024, rs674319, rs675185, rs5792574, rs12275272, rs10400327, rs612255, rs7101643, rs575871, rs547208, rs2511075, rs642573, rs482197, rs656640, rs671681, rs541022, rs951586, rs2511076, rs11235432, rs3018308, rs11606798, rs1791544, rs3018304, rs10751193, rs4945470, rs3018291, rs2511120, rs671132, rs4945475, rs3018292, rs642618, rs552966, rs6592459, rs607446, rs607070, rs10713307, rs3018302, rs3750909, rs3018301, rs2511114, rs12270166, rs12270241, rs11606587, rs686340, rs548961, rs549032, rs575831, rs575878, rs577435, rs579320, rs495567, rs636946, rs493065, rs597513, rs598835, rs10683614, rs610004, rs610041, rs673478, rs670802, rs505041, rs2511116, rs628025, rs517837, rs615000, rs482013, rs693391, rs2511079, rs2250866, rs2508860, rs7483267, rs2511078, rs2508859, rs2508858, rs11235435, rs11235436, rs639435, rs12285624, position 112784 of SEQ ID NO: 4, rs624363, position 113614 of SEQ ID NO: 4, rs1053573, rs1053511, rs1063863, rs12137, rs4365081, rs4466868, rs3750911, rs510925, rs595062, rs1053443, rs542752, rs3897579, rs11235437, rs2508856, rs5792575, rs659513, rs10898820, rs2276397, rs3750908, rs3793938, rs602285, rs2276396, rs2276395, rs1806778, rs4073394, rs471547, rs606136, rs605241, rs686063, rs685749, rs533207, rs476753, position 191149 of SEQ ID NO: 4, rs11278712, and rs3831387. Polymorphic variants at the following positions in particular were associated with an increased risk of breast cancer: rs7949480, rs7121260, rs7128317, rs2276385, rs2276383, rs1892921, rs1541306, rs3814721, rs1892919, rs2852365, rs3750913, position 34941 in SEQ ID NO: 4, rs949325, position 35629 in SEQ ID NO: 4, rs2298456, rs1573500, rs4945411, rs10128658, rs2298457, rs3838779, rs10898814, rs7930142, rs7930544, rs7930722, rs1939247, rs1939243, rs4245463, rs4944258, rs7926751, rs1573502, rs7127865, rs1894003, rs4945430, rs1939242, rs10793016, rs4945434, rs678193, rs560777, rs676721, rs585228, rs675185, rs5792574, rs2511075, rs541022, rs1791544, rs642618, rs552966, rs607446, rs3018302, rs3018301, rs2511114, rs548961, rs579320, rs495567, rs493065, rs610004, rs610041, rs673478, rs670802, rs2511116, rs615000, rs482013, rs2511079, rs2250866, rs2508858, rs2276396, and rs11278712. At these positions in SEQ ID NO: 4, a thymine at position 3146, a guanine at position 6124, an adenine at position 6925, a guanine at position 7060, an adenine at position 7090, a cytosine at position 7696, a cytosine at position 13571, a guanine at position 14830, a cytosine at position 17733, a guanine at position 20776, a guanine at position 31726, a cytosine at position 34941, an adenine at position 35214, a guanine at position 35629, a thymine at position 36273, a cytosine at position 38348, a guanine at position 38608, a cytosine at position 39077, a thymine at position 39769, a thymine at position 40555, a thymine at position 42063, a cytosine at position 42574, a cytosine at position 42912, a cytosine at position 43042, a thymine at position 46079, a cytosine at position 48293, a cytosine at position 48771, a thymine at position 48951, a thymine at position 49972, a guanine at position 52986, a guanine at position 53339, a thymine at position 55834, a guanine at position 58703, a cytosine at position 59140, a guanine at position 60621, a cytosine at position 64645, a thymine at position 75831, a thymine at position 76160, a cytosine at position 76196, a cytosine at position 78847, a thymine at position 81130, a deletion at position 81452, a thyrnine at position 85815, a guanine at position 88614, a cytosine at position 90515, a cytosine at position 93751, an adenine at position 93775, a cytosine at position 94810, a thymine at position 96500, an adenine at position 97629, a thymine at position 97705, a guanine at position 99445, a guanine at position 100512, a cytosine at position 101046, an adenine at position 102487, a cytosine at position 103497, an adenine at position 103526, a cytosine at position 104662, a thymine at position 105226, a cytosine at position 107718, a thymine at position 108510, a cytosine at position 109520, a cytosine at position 109712, a thymine at position 110071, a cytosine at position 110963, a guanine at position 129463, and a "GTCAAC" at positions 34468-34472, in particular were associated with risk of breast cancer.

[0045] In the GALE locus, these included polymorphic variants at positions selected from the group consisting of rs627451, rs12082331, rs2267960, rs7519640, rs12086741, rs3934189, rs12135415, rs12088267, rs12084665, rs550850, rs557227, rs12137502, rs12118858, rs2294495, rs12401650, rs2235541, rs520713, rs550252, position 12668 of SEQ ID NO: 5, rs12093683, rs10917421, rs2744873, rs12091764, position 15761 of SEQ ID NO: 5, rs2076345, rs2076346, rs2473379, rs6679300, rs11811395, rs8179467, rs8179468, rs10917423, rs7536699, rs3215497, rs1000213, rs1000212, rs1000211, rs1045017, rs12059520, rs2143118, rs12126804, rs533276, rs12402174, rs2864110, rs11581873, rs12062449, rs12033190, rs10157566, rs486746, rs11802707, rs6668550, rs7410946, rs7410970, rs6657558, rs2143119, rs7514394, rs11591202, rs6673991, position 37720 of SEQ ID NO: 5, rs12034848, rs2502984, rs3831910, rs11379444, rs725119, rs10917425, rs12077788, rs12077830, rs2473380, rs2473381, rs11545132, rs1046924, rs4237, rs4375317, rs11584220, rs2232975, rs2502985, rs3835423, rs2232976, rs2232977, rs2232978, rs2232979, rs2232980, rs2232981, rs2232982, rs2232983, rs2232984, rs2232985, rs2232986, rs2745, rs2744, rs11546127, rs1049988, rs1803613, rs1803612, position 55821 of SEQ ID NO: 5, rs3209973, rs3180545, rs3180383, rs3177814, rs3180546, rs3180547, rs11805398, rs760941, rs3177813, rs3180548, rs3179864, rs3177812, rs3179863, rs6692104, rs3180549, rs3179862, rs3177811, rs3177810, rs3180382, rs11546126, rs7551384, rs12141511, rs2473382, rs12038166, rs6666908, rs12041159, rs12031592, rs1062598, rs11714, rs3203593, rs1042436, rs2076343, rs12131539, rs11583935, rs12140263, rs3835225, rs2473374, rs2256179, rs974698, rs1018396, rs719399, rs719400, rs2502986, rs6679378, rs2473375, rs2473376, rs12136455, rs2502987, rs11551767, rs11591205, rs12083298, rs12138604, rs12136042, rs12138606, rs12136045, rs12116596, rs12138610, rs12136069, rs12116617, rs7540056, rs12044452, rs2076344, rs11588187, rs6696932, rs12025531, rs6682888, rs2982390, rs2179394, rs2473377, rs2179395, rs2502978, rs2502979, rs6698535, rs2502980, rs6697805, rs6424114, rs5773058, rs4649114, rs6424115 and rs10554242. Polymorphic variants at the following positions in particular were associated with an increased risk of breast cancer: rs2294495, position 15761 of SEQ ID NO: 5, rs8179467, rs11591202, rs12034848, rs3831910, rs4237, rs2232982, rs12041159, rs2076343, rs1018396, rs12044452, rs2982390, rs2502980, rs6697805, and rs10554242. At these positions in SEQ ID NO: 5, a cytosine at position 9351, a thymine at position 15761, a thymine at position 18220, an adenine at position 35555, a thymine at position 38304, an adenine at position 39985, an adenine at position 47604, a thymine at position 53102, a guanine at position 61135, an adenine at position 62601, a thymine at position 67087, a guanine at position 77120, a cytosine at position 81305, a cytosine at position 83464, a cytosine at position 85471, and a deletion at positions 83916-83920, in particular were associated with risk of breast cancer.

[0046] In the DPF3 locus, these included polymorphic variants at positions selected from the group consisting of rs11846274, rs2526935, rs929328, rs3742840, rs9671739, rs8006208, rs8006230, rs8007836, rs8006889, rs8010823, rs8011029, rs10649920, rs2803956, rs2803957, rs2526934, rs9671558, rs2526933, rs2803959, rs2526932, rs2803960, rs12434675, rs4899435, rs2526931, rs2803961, rs2803962, rs12590634, rs11327712, rs2803963, rs11844834, rs11320415, rs8012752, rs11623878, rs11623926, rs12434442, rs2526930, rs12435306, rs10144028, rs4899436, rs7140593, rs2107687, rs991882, rs3327, rs2526928, rs7401336, rs2526926, rs994760, rs994759, rs994758, rs11848404, rs2526925, rs11844236, rs2526924, rs2803965, rs2526923, rs7152467, rs11623462, rs2803966, rs2526922, rs2526920, rs11848135, rs11629210, rs2803967, rs16455, rs757655, rs5809581, rs3057139, rs2247658, rs11625609, rs8005580, rs8010472, rs2526919, rs2803968, rs11623943, rs11623946, rs1557926, rs12434611, rs2526918, rs5809582, rs8008279, rs2803969, rs2526917, rs8008774, rs2803970, rs8010255, rs2997642, rs2803971, rs11313760, rs2803972, rs4903038, rs2526916, rs4903040, rs2803974, rs2803975, rs2803976, rs2803977, rs10139909, rs722945, rs917069, rs2803978, rs2332890, rs1989638, rs10679174, rs2526915, rs2526914, rs11158964, rs11158965, rs740081, rs740080, rs10140582, rs2526913, rs4899437, rs10145678, rs2107686, rs2107685, rs2107684, rs7154188, rs4903041, rs7159637, rs6574089, rs12589753, rs4899438, rs4903042, rs4903043, rs2803980, rs10483848, rs2240344, rs2286068, rs11339669, rs3854, rs11463, rs1383, rs1381, rs1377, rs11158966, rs11158967, rs11158968, rs11158969, rs11158970, rs11158971, rs11849782, rs10137616, rs757572, rs10140566, rs2023480, rs2526911, rs4903044, rs11845162, rs12147210, rs2997643, rs2997644, rs3814867, rs2286067, rs1060570, rs2332891, rs2021736, rs7160830, rs2526909, rs7140963, rs10143667, rs2803981, rs768840, rs5809587, rs2023479, rs4903045, rs4903046, rs5809588, rs10220555, rs2906132, rs11848482, rs10129954, rs2526921, rs4903047, rs11846357, rs10136385, rs12588242, rs11621517, rs2526910, rs2526941, rs2803944, rs12436770, rs10220279, rs10220280, rs11844112, rs12432455, rs8015338, rs3832969, rs9671972, rs9671975, rs7159986, rs11848220, rs5016369, rs1986423, rs2332909, rs8013337, rs11445680, rs4903048, rs12434793, rs2332910, rs4410017, rs4577019, rs2332911, rs4996747, rs10140820, rs12431623, rs6574090, rs8008750, rs11627420, rs10150185, rs10150218, rs9646164, rs6574091, rs2332912, rs7155359, rs2332913, rs4544184, rs4337224, rs2332914, rs4280167, rs4903049, rs3742837, rs10139937, rs12434292, rs11620671, rs10140184, rs2332915, rs2332916, rs8012759, rs10149272, rs11158973, rs4903050, rs10666445, rs2536143, rs10638231, rs12431636, rs8005904, rs11621058, rs10133224, rs12433185, rs740974, rs740973, rs740972, rs740971, rs4243642, rs4415952, rs2215589, rs4343211, rs2536142, rs11293340, rs10151620, rs2286840, rs8023089, rs8008009, rs11419089, rs10694676, rs2536141, rs765247, rs7147626, rs10132629, rs4903051, rs11158974, rs1035021, rs6574093, rs4899439, rs7155287, rs7154402, rs7154781, rs6574094, rs10132242, rs10146959, rs10147466, rs11626411, rs4899440, rs10144553, rs11627663, rs11627799, rs11851733, rs10140317, rs8007375, rs4899441, rs11158975, rs11419607, rs2109793, rs8023156, rs10140579, rs7148199, rs7146916, rs1990439, rs6574095, rs10140037, rs8007249, rs1990438, rs1990437, rs10146484, rs11627333, rs7155802, rs2109792, rs11429363, rs8004210, rs2098194, rs2109791, rs11381729, rs1160094, rs11628051, rs10136771, rs10139903, rs4903053, rs3742836, rs3742835, rs8003233, rs11621588, rs740981, rs8019492, rs8019644, rs8019646, rs8019653, rs11450794, rs11348193, rs11450793, rs11282735, rs2191823, rs12232220, rs11158976, rs4903054, rs11846755, rs12431988, rs12100526, rs11622568, rs9671230, rs12147487, rs4903055, rs12147515, rs11625092, rs4899442, rs2052146, rs10220553, rs10220565, rs2332917, rs7158910, rs8015749, rs8006812, rs8008338, rs2052145, rs2052144, rs10146692, rs11627305, rs2079989, rs8018881, rs4561387, rs11622025, rs740980, rs12433250, rs5809590, rs758915, rs758914, rs7154229, rs12437188, rs7159108, rs4903058, rs4899443, rs11848907, rs12432148, rs12435078, rs6574096, rs11158977, rs11629434, rs4378563, rs2098195, rs4633653, rs7148350, rs740979, rs740978, rs740977, rs740976, rs4903059, rs4903060, rs11852056, rs9635257, rs9635258, rs9635259, rs4899444, rs12435382, rs12435412, rs11627381, rs2052143, rs2052142, rs2052141, rs8021035, rs11158978, rs11621216, rs10130873, rs11621358, rs758913, rs11622602, rs10136931, rs740975, rs747987, rs11623819, rs12434445, rs8003375, rs10143596, rs12435321, rs12435401, rs8010609, rs11158979, rs11158980, rs11627524, rs1126160, rs10136074, rs4903061, rs10665398, rs6574097, rs9671654, rs10140024, rs10142421, rs10142593, rs11423372, rs5809592, rs2332918, rs2332919, rs8007348, rs1990443, rs8007690, rs3937455, rs8012823, rs4899445, rs4903062, rs973963, rs10149962, rs8003449, rs11620775, rs8009089, rs8008967, rs12050132, rs10133018, rs1990442, rs1990441, rs8015833, rs1990440, rs4903063, rs10139810, rs4903064, rs2159715, rs2109795, rs2159714, rs11623107, rs7152005, rs7152489, rs4479167, rs4606655, rs4606656, rs4489943, rs7142642, rs8006233, rs8007559, rs8006156, rs1468662, rs11627048, rs6574098, rs12433760, rs12433780, rs12434506, rs12434673, rs12431400, rs12431384, rs4903067, rs2332920, rs2215591, rs12433064, rs12436263, rs12433097, rs12433184, rs8015900, rs11296981, rs11344025, rs11464204, rs11441172, rs11381807, rs10873251, rs2109794, rs10873252, rs4520784, rs2877820, rs2877821, rs4569195, rs11628905, rs2191822, rs2191821, rs11464689, rs12431959, rs4903068, rs1544579, rs7155879, rs12433603, rs11351432, rs11448438, rs4243643, rs4140952, rs8005372, rs8004109, rs8008398, rs8009692, rs2332921, rs12050320, rs12050323, rs8010316, rs7154293, rs12147969, rs2215590, rs4265749, rs1004552, rs4307892, rs12431973, rs12431975, rs767874, rs11628597, rs10129371, rs4903069, rs4903070, rs4903071, rs11622224, rs10459455, rs9323577, rs10624648, rs3058953, rs11158981, rs11158982, rs11158983, rs1860750, rs1860749, rs1860748, rs1860747, rs11419679, rs8011777, rs6574099, rs8010957, rs11626895, rs10151431, rs4903072, rs4589489, rs9671327, rs4899446, rs10144501, rs5809594, rs720317, rs8014316, rs11158984, rs6420906, rs8004055, rs12434800, rs4243644, rs4899447, rs4903073, rs11848634, rs4899448, rs10131564, rs10134150, rs763388, rs11845938, rs11845946, rs11845915, rs10137463, rs6574100, rs7140344, rs10646889, rs7146287, rs5809595, rs1035099, rs7159877, rs7142579, rs12431762, rs12431764, rs10647999, rs6574101, rs6574102, rs1861162, rs12432972, rs10146134, rs10146616, rs10146769, rs8018936, rs10483849, rs2160137, rs2192595, rs2192594, rs11271695, rs10747301, rs12050363, rs12050368, rs12432949, rs7401375, rs8019682, rs8021248, rs11158985, rs10483850, rs8010875, rs11626844, rs982972, rs7161198, rs7160347, rs8007139, rs8014483, rs12437072, rs8004767, rs12588830, rs7158449, rs6574103, rs8020478, rs4903077, rs8012359, rs4899449, rs10690289, rs6574104, rs2110552, rs8008256, rs759283, rs4999177, rs2333006, rs8006178, rs11158986, rs7150625, rs8007768, rs8007058, position 284742 of SEQ ID NO: 6, rs2215901, rs3814866, rs3814864, and rs10605948. Polymorphic variants at the following positions in particular were associated with an increased risk of breast cancer: rs3327, rs2526926, rs2526914, rs2526913, rs2526921, rs7159986, rs2332916, rs10132242, rs11627663, rs4899441, rs7148199, rs1990437, rs8004210, rs8019653, rs12232220, rs4899442, rs2332917, rs8015749, rs12437188, rs12432148, rs4378563, rs740978, rs740976, rs4903059, rs4903060, rs9635259, rs2052142, rs758913, rs747987, rs11423372, rs5809592, rs8007348, rs4899445, rs4903062, rs1990440, rs4479167, rs4606655, rs4606656, rs4489943, rs8007559, rs8006156, rs12431400, rs12431384, rs12433097, rs12433184, rs2877821, rs4569195, rs11628905, rs2191822, rs12433603, rs11448438, rs8009692, rs4265749, rs4307892, rs12431975, rs4903071, rs1860749, rs1860748, rs8010957, rs6420906, rs12434800, rs7142579, rs8010875, rs8004767, rs4899449, and rs10605948. At these positions in SEQ ID NO: 6, a thymine at position 17641, a thymine at position 19527, a thymine at position 40889, an adenine at position 44877, a cytosine at position 75061, a thymine at position 86006, a cytosine at position 106988, a guanine at position 122783, a cytosine at position 125329, an adenine at position 127544, a cytosine at position 131734, a cytosine at position 137499, an adenine at position 139319, a guanine at position 147479, a guanine at position 150798, a guanine at position 160835, a guanine at position 163447, a guanine at position 164377, a cytosine at position 171972, a guanine at position 173467, a thymine at position 177780, a guanine at position 179608, a thymine at position 179808, a cytosine at position 180041, a guanine at position 181420, a guanine at position 182248, a guanine at position 185633, a guanine at position 188352, a thymine at position 189444, a cytosine at position 196415, a cytosine at position 196417, an adenine at position 196621, a guanine at position 197612, a cytosine at position 197854, a guanine at position 201045, a cytosine at position 205135, a thymine at position 205269, a thymine at position 205323, an adenine at position 205364, an adenine at position 206786, a guanine at position 206796, a thymine at position 209750, a guanine at position 209817, a guanine at position 211659, a thymine at position 211757, an adenine at position 213029, a guanine at position 213095, a cytosine at position 214247, a cytosine at position 214807, a guanine at position 217143, a guanine at position 217725, a thymine at position 218890, a thymine at position 222234, an adenine at position 222458, an adenine at position 222749, a thymine at position 227815, an adenine at position 233670, a cytosine at position 233702, a guanine at position 237317, a thymine at position 242360, an adenine at position 243355, an adenine at position 251858, a guanine at position 267130, a cytosine at position 273399, a guanine at position 277166, and a deletion at positions 250079-250082, in particular were associated with risk of breast cancer.

[0047] In the LOC145197 locus, these included polymorphic variants at positions selected from the group consisting of rs2895907, rs2401019, rs2401020, rs2401021, rs1999611, rs1999610, rs1999609, rs2275016, rs2275015, rs3818772, rs10149458, rs7142383, rs11343023, rs11160641, rs12586334, rs10142208, rs7493230, rs5811036, rs10151926, rs12435354, rs7151007, rs11160642, rs11160643, rs11626687, rs4906112, rs8016071, rs11623698, rs7401628, rs8015995, rs10873526, rs11160644, rs10134252, rs1959030, rs9707396, rs2401022, rs4622448, rs10141019, rs10141096, rs11621063, rs12434632, rs12100901, rs12434655, rs9944103, rs7153189, rs7158860, rs12437080, rs11851768, rs12431943, rs4309341, rs4329858, rs10690268, rs2401023, rs1054745, rs8019453, rs12431510, rs7141067, rs12431547, rs7142316, rs1959029, rs1959028, rs11376292, rs11376755, rs7145420, rs8013347, rs2144070, rs11850135, rs11850138, rs1955617, rs11621899, rs4900508, rs4906116, rs4906117, rs2235972, rs2235973, rs2235974, rs2235975, rs7149416, rs11850809, rs10140476, rs12437309, rs6575852, rs4906118, rs11428825, rs11450744, rs1999612, rs1889368, rs1889367, rs1889366, rs3077388, rs1889365, rs1955615, rs1569807, rs2064491, rs2064492, rs761532, rs1955616, rs2144065, rs2144066, rs2895908, rs2401043, rs1007904, rs3891113, rs3891114, rs730812, rs1884068, and rs1884069. Polymorphic variants at the following positions in particular were associated with an increased risk of breast cancer: rs12437080, rs12431943, rs1054745, rs8019453, rs12431547, rs1959029, rs1959028, rs8013347, rs2235972, rs2235973, rs2235974, and rs2895908. At these positions in SEQ ID NO: 7, a guanine at position 41414, an adenine at position 42821, an adenine at position 46344, a cytosine at position 46669, an adenine at position 47293, a guanine at position 49821, a thymine at position 49875, a thymine at position 51912, a cytosine at position 55799, a cytosine at position 55995, an adenine at position 56042, and an adenine at position 75221, in particular were associated with risk of breast cancer.

[0048] Based in part upon analyses summarized in FIGS. 1A-1G, regions with significant association have been identified in ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 and LOC145197 regions associated with increased risk of breast cancer. Any polymorphic variants associated with an increased risk of breast cancer in a region of significant association can be utilized for embodiments described herein. The following reports such a region, where "begin" and "end" designate the boundaries of the region according to chromosome positions within NCBI's Genome Build 34. For example, a region spanning positions 184215647 to 184249849 in the KIAA0861 locus was significantly associated with an increased risk of breast cancer.

2 rs # Region Region of Association Distance 4237 HT014 region 23545351 23622196 76845 2001449 KIAA0861 184215647 184249849 34202 1541998 MAPK10 87386018 87442874 56856 673478 NUMA1 71423896 71531713 107817 1054745 LOC145197 99895564 99929371 33807 1990440 DPF3 71078327 71343316 264989 11549918 ICAM1,4,5 10231542 10268169 36627

[0049] The embodiments described hereafter may be directed to any of the polymorphic variants described herein. Sometimes, embodiments are directed to any of the polymorphic variants described herein with the proviso that the embodiments are not directed to a polymorphic variant at one or more positions selected from the group consisting of rs11549918, rs1541998, rs2001449, rs673478, rs4237, rs1990440 and rs1054745.

[0050] Additional Polymorphic Variants Associated with Breast Cancer

[0051] Also provided is a method for identifying polymorphic variants proximal to an incident, founder polymorphic variant associated with breast cancer. Thus, featured herein are methods for identifying a polymorphic variation associated with breast cancer that is proximal to an incident polymorphic variation associated with breast cancer, which comprises identifying a polymorphic variant proximal to the incident polymorphic variant associated with breast cancer, where the incident polymorphic variant is in a nucleotide sequence set forth in SEQ ID NO: 1-7. The nucleotide sequence often comprises a polynucleotide sequence selected from the group consisting of (a) a nucleotide sequence set forth in SEQ ID NO: 1-7; (b) a nucleotide sequence which encodes a polypeptide having an amino acid sequence encoded by a nucleotide sequence in SEQ ID NO: 1-7; (c) a nucleotide sequence which encodes a polypeptide that is 90% or more identical to an amino acid sequence encoded by a nucleotide sequence in SEQ ID NO: 1-7 or a nucleotide sequence about 90% or more identical to the nucleotide sequence set forth in SEQ ID NO: 1-7; and (d) a fragment of a nucleotide sequence of (a), (b), or (c), often a fragment that includes a polymorphic site associated with breast cancer. The presence or absence of an association of the proximal polymorphic variant with breast cancer then is determined using a known association method, such as a method described in the Examples hereafter. In an embodiment, the incident polymorphic variant is described in SEQ ID NO: 1-7. In another embodiment, the proximal polymorphic variant identified sometimes is a publicly disclosed polymorphic variant, which for example, sometimes is published in a publicly available database. In other embodiments, the polymorphic variant identified is not publicly disclosed and is discovered using a known method, including, but not limited to, sequencing a region surrounding the incident polymorphic variant in a group of nucleic acid samples. Thus, multiple polymorphic variants proximal to an incident polymorphic variant are associated with breast cancer using this method.

[0052] The proximal polymorphic variant often is identified in a region surrounding the incident polymorphic variant. In certain embodiments, this surrounding region is about 50 kb flanking the first polymorphic variant (e.g. about 50 kb 5' of the first polymorphic variant and about 50 kb 3' of the first polymorphic variant), and the region sometimes is composed of shorter flanking sequences, such as flanking sequences of about 40 kb, about 30 kb, about 25 kb, about 20 kb, about 15 kb, about 10 kb, about 7 kb, about 5 kb, or about 2 kb 5' and 3' of the incident polymorphic variant. In other embodiments, the region is composed of longer flanking sequences, such as flanking sequences of about 55 kb, about 60 kb, about 65 kb, about 70 kb, about 75 kb, about 80 kb, about 85 kb, about 90 kb, about 95 kb, or about 100 kb 5' and 3' of the incident polymorphic variant.

[0053] In certain embodiments, polymorphic variants associated with breast cancer are identified iteratively. For example, a first proximal polymorphic variant is associated with breast cancer using the methods described above and then another polymorphic variant proximal to the first proximal polymorphic variant is identified (e.g., publicly disclosed or discovered) and the presence or absence of an association of one or more other polymorphic variants proximal to the first proximal polymorphic variant with breast cancer is determined.

[0054] The methods described herein are useful for identifying or discovering additional polymorphic variants that may be used to further characterize a gene, region or loci associated with a condition, a disease (e.g., breast cancer), or a disorder. For example, allelotyping or genotyping data from the additional polymorphic variants may be used to identify a functional mutation or a region of linkage disequilibrium.

[0055] In certain embodiments, polymorphic variants identified or discovered within a region comprising the first polymorphic variant associated with breast cancer are genotyped using the genetic methods and sample selection techniques described herein, and it can be determined whether those polymorphic variants are in linkage disequilibrium with the first polymorphic variant. The size of the region in linkage disequilibrium with the first polymorphic variant also can be assessed using these genotyping methods. Thus, provided herein are methods for determining whether a polymorphic variant is in linkage disequilibrium with a first polymorphic variant associated with breast cancer, and such information can be used in prognosis methods described herein.

[0056] Isolated ICAM, MAPK10, KIAA0861. NUMA1. GALE, DPF3 and LOC145197 Nucleic Acids

[0057] Featured herein are isolated ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleic acids, which include the nucleic acid having the nucleotide sequence of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11, nucleic acid variants, and substantially identical nucleic acids of the foregoing. Nucleotide sequences of the ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleic acids sometimes are referred to herein as "ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleotide sequences." An "ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleic acid variant" refers to one allele that may have one or more different polymorphic variations as compared to another allele in another subject or the same subject. A polymorphic variation in the ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleic acid variant may be represented on one or both strands in a double-stranded nucleic acid or on one chromosomal complement (heterozygous) or both chromosomal complements (homozygous).

[0058] As used herein, the term "nucleic acid" includes DNA molecules (e.g., a complementary DNA (cDNA) and genomic DNA (gDNA)) and RNA molecules (e.g., mRNA, rRNA, and tRNA) and analogs of DNA or RNA, for example, by use of nucleotide analogs. The nucleic acid molecule can be single-stranded and it is often double-stranded. The term "isolated or purified nucleic acid" refers to nucleic acids that are separated from other nucleic acids present in the natural source of the nucleic acid. For example, with regard to genomic DNA, the term "isolated" includes nucleic acids which are separated from the chromosome with which the genomic DNA is naturally associated. An "isolated" nucleic acid is often free of sequences which naturally flank the nucleic acid (i.e., sequences located at the 5' and/or 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, the isolated nucleic acid molecule can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of 5' and/or 3' nucleotide sequences which flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived. Moreover, an "isolated" nucleic acid molecule, such as a cDNA molecule, can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. As used herein, the term "ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 gene" refers to a nucleotide sequence that encodes a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide.

[0059] Also included herein are nucleic acid fragments. These fragments typically are a nucleotide sequence identical to a nucleotide sequence in SEQ ID NO: 1-17, a nucleotide sequence substantially identical to a nucleotide sequence in SEQ ID NO: 1-17, or a nucleotide sequence that is complementary to the foregoing. The nucleic acid fragment may be identical, substantially identical or homologous to a nucleotide sequence in an exon or an intron in SEQ ID NO: 1-7, and may encode a domain or part of a domain or motif of a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide. Sometimes, the fragment will comprises the polymorphic variation described herein as being associated with breast cancer. The nucleic acid fragment sometimes is 50, 100, or 200 or fewer base pairs in length, and is sometimes about 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3800, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 15000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000, 100000, 110000, 120000, 130000, 140000, 150000 or 160000 base pairs in length. A nucleic acid fragment complementary to a nucleotide sequence identical or substantially identical to the nucleotide sequence of SEQ ID NO: 1-17 and hybridizes to such a nucleotide sequence under stringent conditions often is referred to as a "probe." Nucleic acid fragments often include one or more polymorphic sites, or sometimes have an end that is adjacent to a polymorphic site as described hereafter.

[0060] An example of a nucleic acid fragment is an oligonucleotide. As used herein, the term "oligonucleotide" refers to a nucleic acid comprising about 8 to about 50 covalently linked nucleotides, often comprising from about 8 to about 35 nucleotides, and more often from about 10 to about 25 nucleotides. The backbone and nucleotides within an oligonucleotide may be the same as those of naturally occurring nucleic acids, or analogs or derivatives of naturally occurring nucleic acids, provided that oligonucleotides having such analogs or derivatives retain the ability to hybridize specifically to a nucleic acid comprising a targeted polymorphism. Oligonucleotides described herein may be used as hybridization probes or as components of prognostic or diagnostic assays, for example, as described herein.

[0061] Oligonucleotides are typically synthesized using standard methods and equipment, such as the ABI 3900 High Throughput DNA Synthesizer and the EXPEDITE.TM. 8909 Nucleic Acid Synthesizer, both of which are available from Applied Biosystems (Foster City, Calif.). Analogs and derivatives are exemplified in U.S. Pat. Nos. 4,469,863; 5,536,821; 5,541,306; 5,637,683; 5,637,684; 5,700,922; 5,717,083; 5,719,262; 5,739,308; 5,773,601; 5,886,165; 5,929,226; 5,977,296; 6,140,482; WO 00/56746; WO 01/14398, and related publications. Methods for synthesizing oligonucleotides comprising such analogs or derivatives are disclosed, for example, in the patent publications cited above and in U.S. Pat. Nos. 5,614,622; 5,739,314; 5,955,599; 5,962,674; 6,117,992; in WO 00/75372; and in related publications.

[0062] Oligonucleotides also may be linked to a second moiety. The second moiety may be an additional nucleotide sequence such as a tail sequence (e.g., a polyadenosine tail), an adapter sequence (e.g., phage M13 universal tail sequence), and others. Alternatively, the second moiety may be a non-nucleotide moiety such as a moiety which facilitates linkage to a solid support or a label to facilitate detection of the oligonucleotide. Such labels include, without limitation, a radioactive label, a fluorescent label, a chemiluminescent label, a paramagnetic label, and the like. The second moiety may be attached to any position of the oligonucleotide, provided the oligonucleotide can hybridize to the nucleic acid comprising the polymorphism.

[0063] Uses for Nucleic Acid Sequences

[0064] Nucleic acid coding sequences depicted in SEQ ID NO: 1-17 may be used for diagnostic purposes for detection and control of polypeptide expression. Also, included herein are oligonucleotide sequences such as antisense RNA, small-interfering RNA (siRNA) and DNA molecules and ribozymes that function to inhibit translation of a polypeptide. Antisense techniques and RNA interference techniques are known in the art and are described herein.

[0065] Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by a endonucleolytic cleavage. Ribozymes may be engineered hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleolytic cleavage of RNA sequences corresponding to or complementary to the nucleotide sequences set forth in SEQ ID NO: 1-17. Specific ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences, GUA, GUU and GUC. Once identified, short RNA sequences of between fifteen (15) and twenty (20) ribonucleotides corresponding to the region of the target gene containing the cleavage site may be evaluated for predicted structural features such as secondary structure that may render the oligonucleotide sequence unsuitable. The suitability of candidate targets may also be evaluated by testing their accessibility to hybridization with complementary oligonucleotides, using ribonuclease protection assays.

[0066] Antisense RNA and DNA molecules, siRNA and ribozymes may be prepared by any method known in the art for the synthesis of RNA molecules. These include techniques for chemically synthesizing oligodeoxyribonucleotides well known in the art such as solid phase phosphoramidite chemical synthesis. Alternatively, RNA molecules may be generated by in vitro and in vivo transcription of DNA sequences encoding the antisense RNA molecule. Such DNA sequences may be incorporated into a wide variety of vectors which incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters. Alternatively, antisense cDNA constructs that synthesize antisense RNA constitutively or inducibly, depending on the promoter used, can be introduced stably into cell lines.

[0067] DNA encoding a polypeptide also may have a number of uses for the diagnosis of diseases, including breast cancer, resulting from aberrant expression of a target gene described herein. For example, the nucleic acid sequence may be used in hybridization assays of biopsies or autopsies to diagnose abnormalities of expression or function (e.g., Southern or Northern blot analysis, in situ hybridization assays).

[0068] In addition, the expression of a polypeptide during embryonic development may also be determined using nucleic acid encoding the polypeptide. As addressed, infra, production of functionally impaired polypeptide can be the cause of various disease states, such as breast cancer. In situ hybridizations using polynucleotide probes may be employed to predict problems related to breast cancer. Further, as indicated, infra, administration of human active polypeptide, recombinantly produced as described herein, may be used to treat disease states related to functionally impaired polypeptide. Alternatively, gene therapy approaches may be employed to remedy deficiencies of functional polypeptide or to replace or compete with dysfunctional polypeptide.

[0069] Expression Vectors. Host Cells, and Genetically Engineered Cells

[0070] Provided herein are nucleic acid vectors, often expression vectors, which contain a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleic acid. As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked and can include a plasmid, cosmid, or viral vector. The vector can be capable of autonomous replication or it can integrate into a host DNA. Viral vectors may include replication defective retroviruses, adenoviruses and adeno-associated viruses for example.

[0071] A vector can include a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleic acid in a form suitable for expression of the nucleic acid in a host cell. The recombinant expression vector typically includes one or more regulatory sequences operatively linked to the nucleic acid sequence to be expressed. The term "regulatory sequence" includes promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Regulatory sequences include those that direct constitutive expression of a nucleotide sequence, as well as tissue-specific regulatory and/or inducible sequences. The design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of polypeptide desired, and the like. Expression vectors can be introduced into host cells to produce ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptides, including fusion polypeptides, encoded by ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleic acids.

[0072] Recombinant expression vectors can be designed for expression of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptides in prokaryotic or eukaryotic cells. For example, ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptides can be expressed in E. coli, insect cells (e.g., using baculovirus expression vectors), yeast cells, or mammalian cells. Suitable host cells are discussed further in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990). Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.

[0073] Expression of polypeptides in prokaryotes is most often carried out in E. coli with vectors containing constitutive or inducible promoters directing the expression of either fusion or non-fusion polypeptides. Fusion vectors add a number of amino acids to a polypeptide encoded therein, usually to the amino terminus of the recombinant polypeptide. Such fusion vectors typically serve three purposes: 1) to increase expression of recombinant polypeptide; 2) to increase the solubility of the recombinant polypeptide; and 3) to aid in the purification of the recombinant polypeptide by acting as a ligand in affinity purification. Often, a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant polypeptide to enable separation of the recombinant polypeptide from the fusion moiety subsequent to purification of the fusion polypeptide. Such enzymes, and their cognate recognition sequences, include Factor Xa, thrombin and enterokinase. Typical fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith & Johnson, Gene 67: 3140 (1988)), pMAL (New England Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia, Piscataway, N.J.) which fuse glutathione S-transferase (GST), maltose E binding polypeptide, or polypeptide A, respectively, to the target recombinant polypeptide.

[0074] Purified fusion polypeptides can be used in screening assays and to generate antibodies specific for ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptides. In a therapeutic embodiment, fusion polypeptide expressed in a retroviral expression vector is used to infect bone marrow cells that are subsequently transplanted into irradiated recipients. The pathology of the subject recipient is then examined after sufficient time has passed (e.g., six (6) weeks).

[0075] Expressing the polypeptide in host bacteria with an impaired capacity to proteolytically cleave the recombinant polypeptide is often used to maximize recombinant polypeptide expression (Gottesman, S., Gene Expression Technology: Methods in Enzymology, Academic Press, San Diego, Calif. 185: 119-128 (1990)). Another strategy is to alter the nucleotide sequence of the nucleic acid to be inserted into an expression vector so that the individual codons for each amino acid are those preferentially utilized in E. coli (Wada et al., Nucleic Acids Res. 20: 2111-2118 (1992)). Such alteration of nucleotide sequences can be carried out by standard DNA synthesis techniques.

[0076] When used in mammalian cells, the expression vector's control functions are often provided by viral regulatory elements. For example, commonly used promoters are derived from polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40. Recombinant mammalian expression vectors are often capable of directing expression of the nucleic acid in a particular cell type (e.g., tissue-specific regulatory elements are used to express the nucleic acid). Non-limiting examples of suitable tissue-specific promoters include an albumin promoter (liver-specific; Pinkert et al., Genes Dev. 1: 268-277 (1987)), lymphoid-specific promoters (Calame & Eaton, Adv. Immunol. 43: 235-275 (1988)), promoters of T cell receptors (Winoto & Baltimore, EMBO J. 8: 729-733 (1989)) promoters of immunoglobulins (Banerji et al., Cell 33: 729-740 (1983); Queen & Baltimore, Cell 33: 741-748 (1983)), neuron-specific promoters (e.g., the neurofilament promoter; Byrne & Ruddle, Proc. Natl. Acad. Sci. USA 86: 5473-5477 (1989)), pancreas-specific promoters (Edlund et al., Science 230: 912-916 (1985)), and mammary gland-specific promoters (e.g., milk whey promoter; U.S. Pat. No. 4,873,316 and European Application Publication No. 264,166). Developmentally-regulated promoters are sometimes utilized, for example, the murine hox promoters (Kessel & Gruss, Science 249: 374-379 (1990)) and the a-fetopolypeptide promoter (Campes & Tilghman, Genes Dev. 3: 537-546 (1989)).

[0077] A ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleic acid may also be cloned into an expression vector in an antisense orientation. Regulatory sequences (e.g., viral promoters and/or enhancers) operatively linked to a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleic acid cloned in the antisense orientation can be chosen for directing constitutive, tissue specific or cell type specific expression of antisense RNA in a variety of cell types. Antisense expression vectors can be in the form of a recombinant plasmid, phagemid or attenuated virus. For a discussion of the regulation of gene expression using antisense genes see Weintraub et al., Antisense RNA as a molecular tool for genetic analysis, Reviews--Trends in Genetics, Vol. 1(1) (1986).

[0078] Also provided herein are host cells that include a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleic acid within a recombinant expression vector or ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleic acid sequence fragments which allow it to homologously recombine into a specific site of the host cell genome. The terms "host cell" and "recombinant host cell" are used interchangeably herein. Such terms refer not only to the particular subject cell but rather also to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein. A host cell can be any prokaryotic or eukaryotic cell. For example, a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide can be expressed in bacterial cells such as E. coli, insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells). Other suitable host cells are known to those skilled in the art.

[0079] Vectors can be introduced into host cells via conventional transformation or transfection techniques. As used herein, the terms "transformation" and "transfection" are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, transduction/infection, DEAE-dextran-mediated transfection, lipofection, or electroporation.

[0080] A host cell provided herein can be used to produce (i.e., express) a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide. Accordingly, further provided are methods for producing a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide using the host cells described herein. In one embodiment, the method includes culturing host cells into which a recombinant expression vector encoding a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide has been introduced in a suitable medium such that a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide is produced. In another embodiment, the method further includes isolating a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide from the medium or the host cell.

[0081] Also provided are cells or purified preparations of cells which include a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 transgene, or which otherwise misexpress ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide. Cell preparations can consist of human or non-human cells, e.g., rodent cells, e.g., mouse or rat cells, rabbit cells, or pig cells. In certain embodiments, the cell or cells include a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 transgene (e.g., a heterologous form of a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 such as a human gene expressed in non-human cells). The ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 transgene can be misexpressed, e.g., overexpressed or underexpressed. In other embodiments, the cell or cells include a gene which misexpress an endogenous ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide (e.g., expression of a gene is disrupted, also known as a knockout). Such cells can serve as a model for studying disorders which are related to mutated or mis-expressed ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 alleles or for use in drug screening. Also provided are human cells (e.g., a hematopoietic stem cells) transformed with a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleic acid.

[0082] Also provided are cells or a purified preparation thereof (e.g., human cells) in which an endogenous ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleic acid is under the control of a regulatory sequence that does not normally control the expression of the endogenous ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 gene. The expression characteristics of an endogenous gene within a cell (e.g., a cell line or microorganism) can be modified by inserting a heterologous DNA regulatory element into the genome of the cell such that the inserted regulatory element is operably linked to the endogenous ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 gene. For example, an endogenous ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 gene (e.g., a gene which is "transcriptionally silent," not normally expressed, or expressed only at very low levels) may be activated by inserting a regulatory element which is capable of promoting the expression of a normally expressed gene product in that cell. Techniques such as targeted homologous recombinations, can be used to insert the heterologous DNA as described in, e.g., Chappel, U.S. Pat. No. 5,272,071; WO 91/06667, published on May 16, 1991.

[0083] Transgenic Animals

[0084] Non-human transgenic animals that express a heterologous ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide (e.g., expressed from a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleic acid isolated from another organism) can be generated. Such animals are useful for studying the function and/or activity of a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide and for identifying and/or evaluating modulators of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleic acid and ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide activity. As used herein, a "transgenic animal" is a non-human animal such as a mammal (e.g., a non-human primate such as chimpanzee, baboon, or macaque; an ungulate such as an equine, bovine, or caprine; or a rodent such as a rat, a mouse, or an Israeli sand rat), a bird (e.g., a chicken or a turkey), an amphibian (e.g., a frog, salamander, or newt), or an insect (e.g., Drosophila melanogaster), in which one or more of the cells of the animal includes a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 transgene. A transgene is exogenous DNA or a rearrangement (e.g., a deletion of endogenous chromosomal DNA) that is often integrated into or occurs in the genome of cells in a transgenic animal. A transgene can direct expression of an encoded gene product in one or more cell types or tissues of the transgenic animal, and other transgenes can reduce expression (e.g., a knockout). Thus, a transgenic animal can be one in which an endogenous ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 gene has been altered by homologous recombination between the endogenous gene and an exogenous DNA molecule introduced into a cell of the animal (e.g., an embryonic cell of the animal) prior to development of the animal.

[0085] Intronic sequences and polyadenylation signals can also be included in the transgene to increase expression efficiency of the transgene. One or more tissue-specific regulatory sequences can be operably linked to a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 transgene to direct expression of a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide to particular cells. A transgenic founder animal can be identified based upon the presence of a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 transgene in its genome and/or expression of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 mRNA in tissues or cells of the animals. A transgenic founder animal can then be used to breed additional animals carrying the transgene. Moreover, transgenic animals carrying a transgene encoding a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide can further be bred to other transgenic animals carrying other transgenes.

[0086] ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptides can be expressed in transgenic animals or plants by introducing, for example, a nucleic acid encoding the polypeptide into the genome of an animal. In certain embodiments the nucleic acid is placed under the control of a tissue specific promoter, e.g., a milk or egg specific promoter, and recovered from the milk or eggs produced by the animal. Also included is a population of cells from a transgenic animal.

[0087] ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 and LOC145197 Polypeptides

[0088] Featured herein are isolated ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptides, which include polypeptides having amino acid sequences set forth in SEQ ID NO: 18-27, and substantially identical polypeptides thereof. Such polypeptides sometimes are proteins or peptides. A ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide is a polypeptide encoded by a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleic acid, where one nucleic acid can encode one or more different polypeptides. An "isolated" or "purified" polypeptide or protein is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the protein is derived, or substantially free from chemical precursors or other chemicals when chemically synthesized. In one embodiment, the language "substantially free" means preparation of a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide or ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide variant having less than about 30%, 20%, 10% and sometimes 5% (by dry weight), of non-ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide (also referred to herein as a "contaminating protein"), or of chemical precursors or non-ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 chemicals. When the ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide or a biologically active portion thereof is recombinantly produced, it is also often substantially free of culture medium, specifically, where culture medium represents less than about 20%, sometimes less than about 10%, and often less than about 5% of the volume of the polypeptide preparation. Isolated or purified ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide preparations are sometimes 0.01 milligrams or more or 0.1 milligrams or more, and often 1.0 milligrams or more and 10 milligrams or more in dry weight. In specific embodiments, a polypeptide comprises leucine at amino acid position 359 in SEQ ID NO: 23, a leucine at amino acid position 378 in SEQ ID NO: 23, an alanine at amino acid position 857 in SEQ ID NO: 23, an alanine at position 902 in SEQ ID NO: 23 a proline at amino acid position 352 in SEQ ID NO: 20 and/or an alanine at amino acid position 348 in SEQ ID NO: 20. A polypeptide encoded by a nucleotide sequence in a NUMA1 region (e.g., NUMA1 polypeptide (e.g., SEQ ID NO: 24), FLJ20625 polypeptide (e.g., accession no. NM.sub.--0L7907) and IL18BP polypeptide (e.g., accession nos. NM.sub.--173042, NM.sub.--173043 or NM.sub.--173044)) sometimes includes one or more of the following amino acid variations: a leucine at a position corresponding to amino acid position 73 in an NM.sub.--017907 polypeptide, a glutamine at a position corresponding to amino acid position 772 in SEQ ID NO: 24, a glutamate at a position corresponding to amino acid position 873 in SEQ ID NO: 24, a glycine at a position corresponding to amino acid position 794 in SEQ ID NO: 24, an arginine at a position corresponding to amino acid position 89 in an IL18BP polypeptide, an argenine at a position corresponding to amino acid position 119 in an IL18BP polypeptide, a cysteine at a position corresponding to amino acid position 195 in a IL18BP polypeptide, an alanine at a position corresponding to amino acid position 2049 in SEQ ID NO: 24, a methionine at a position corresponding to amino acid position 1825 in SEQ ID NO: 24, and a glycine at a position corresponding to amino acid position 978 in SEQ ID NO: 24. A polypeptide encoded by a nucleotide sequence in a GALE region (e.g., GALE (e.g., SEQ ID NO: 25), TCEB3 (e.g., accession no. NM.sub.--003198) and HT014 (e.g., accession no. NM.sub.--020362)) sometimes includes one or more of the following amino acid variations: a valine at a position corresponding to amino acid position 298 in a TCEB3 polypeptide, a valine at a position corresponding to amino acid position 490 in a TCEB3 polypeptide, a methionine at a position corresponding to amino acid position 119 in a TCEB3 polypeptide, a glycine at a position corresponding to amino acid position 227 in SEQ ID NO: 25, an aspartate at a position corresponding to amino acid position 231 in SEQ ID NO: 25, an asparagine at a position corresponding to amino acid position 268 in SEQ ID NO: 25, a valine at a position corresponding to amino acid position 283 in SEQ ID NO: 25, a leucine at a position corresponding to amino acid position 215 in SEQ ID NO: 25, a glycine at a position corresponding to amino acid position 235 in SEQ ID NO: 25, a glutamate at a position corresponding to amino acid position 331 in SEQ ID NO: 25, a serine at a position corresponding to amino acid position 191 in a HT014 polypeptide and a tyrosine at a position corresponding to amino acid position 141 in SEQ ID NO: 25.

[0089] In another aspect, featured herein are ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptides and biologically active or antigenic fragments thereof that are useful as reagents or targets in assays applicable to prevention, treatment or diagnosis of breast cancer. In another embodiment, provided herein are ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptides having a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 activity or activities.

[0090] Further included herein are ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide fragments. The polypeptide fragment may be a domain or part of a domain of a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide. The polypeptide fragment is often 50 or fewer, 100 or fewer, or 200 or fewer amino acids in length, and is sometimes 300, 400, 500, 600, 700, or 900 or fewer amino acids in length. In certain embodiments, the polypeptide fragment comprises, consists essentially of, or consists of, at least 6 consecutive amino acids and not more than .sup.121I consecutive amino acids of SEQ ID NO: 18-27, or the polypeptide fragment comprises, consists essentially of, or consists of, at least 6 consecutive amino acids and not more than 543 consecutive amino acids of SEQ ID NO: 18-27.

[0091] ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptides described herein can be used as immunogens to produce anti-ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 antibodies in a subject, to purify ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 ligands or binding partners, and in screening assays to identify molecules which inhibit or enhance the interaction of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 with a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 substrate. Full-length ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptides and polynucleotides encoding the same may be specifically substituted for a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide fragment or polynucleotide encoding the same in any embodiment described herein.

[0092] Substantially identical polypeptides may depart from the amino acid sequences set forth in SEQ ID NO: 18-27 in different manners. For example, conservative amino acid modifications may be introduced at one or more positions in the amino acid sequences of SEQ ID NO: 18-27. A "conservative amino acid substitution" is one in which the amino acid is replaced by another amino acid having a similar structure and/or chemical function. Families of amino acid residues having similar structures and functions are well known. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Also, essential and non-essential amino acids may be replaced. A "non-essential" amino acid is one that can be altered without abolishing or substantially altering the biological function of a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide, whereas altering an "essential" amino acid abolishes or substantially alters the biological function of a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide. Amino acids that are conserved among ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptides are typically essential amino acids.

[0093] Also, ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptides and polypeptide variants may exist as chimeric or fusion polypeptides. As used herein, a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 "chimeric polypeptide" or "fusion polypeptide" includes a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide linked to a non-ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide. A "non-ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide" refers to a polypeptide having an amino acid sequence corresponding to a polypeptide which is not substantially identical to the ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide, which includes, for example, a polypeptide that is different from the ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide and derived from the same or a different organism. The ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide in the fusion polypeptide can correspond to an entire or nearly entire ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide or a fragment thereof. The non-ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide can be fused to the N-terminus or C-terminus of the ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide.

[0094] Fusion polypeptides can include a moiety having high affinity for a ligand. For example, the fusion polypeptide can be a GST-ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 fusion polypeptide in which the ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 sequences are fused to the C-terminus of the GST sequences, or a polyhistidine-ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 fusion polypeptide in which the ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide is fused at the N- or C-terminus to a string of histidine residues. Such fusion polypeptides can facilitate purification of recombinant ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197. Expression vectors are commercially available that already encode a fusion moiety (e.g., a GST polypeptide), and a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleic acid can be cloned into an expression vector such that the fusion moiety is linked in-frame to the ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide. Further, the fusion polypeptide can be a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide containing a heterologous signal sequence at its N-terminus. In certain host cells (e.g., mammalian host cells), expression, secretion, cellular internalization, and cellular localization of a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide can be increased through use of a heterologous signal sequence. Fusion polypeptides can also include all or a part of a serum polypeptide (e.g., an IgG constant region or human serum albumin).

[0095] ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197polypeptides or fragments thereof can be incorporated into pharmaceutical compositions and administered to a subject in vivo. Administration of these ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptides can be used to affect the bioavailability of a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 substrate and may effectively increase or decrease ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 biological activity in a cell or effectively supplement dysfunctional or hyperactive ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide. ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 fusion polypeptides may be useful therapeutically for the treatment of disorders caused by, for example, (i) aberrant modification or mutation of a gene encoding a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide; (ii) mis-regulation of the ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 gene; and (iii) aberrant post-translational modification of a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide. Also, ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptides can be used as immunogens to produce anti-ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 antibodies in a subject, to purify ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 ligands or binding partners, and in screening assays to identify molecules which inhibit or enhance the interaction of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 with a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 substrate.

[0096] In addition, polypeptides can be chemically synthesized using techniques known in the art (See, e.g., Creighton, 1983 Proteins. New York, N.Y.: W.H. Freeman and Company; and Hunkapiller et al., (1984) Nature July 12-18; 310(5973): 105-11). For example, a relative short polypeptide fragment can be synthesized by use of a peptide synthesizer. Furthermore, if desired, non-classical amino acids or chemical amino acid analogs can be introduced as a substitution or addition into the fragment sequence. Non-classical amino acids include, but are not limited to, to the D-isomers of the common amino acids, 2,4-diaminobutyric acid, a-amino isobutyric acid, 4-aminobutyric acid, Abu, 2-amino butyric acid, g-Abu, e-Ahx, 6-amino hexanoic acid, Aib, 2-amino isobutyric acid, 3-amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, b-alanine, fluoroamino acids, designer amino acids such as b-methyl amino acids, Ca-methyl amino acids, Na-methyl amino acids, and amino acid analogs in general. Furthermore, the amino acid can be D (dextrorotary) or L (levorotary).

[0097] Also included are polypeptide fragments which are differentially modified during or after translation, e.g., by glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, and the like. Any of numerous chemical modifications may be carried out by known techniques, including but not limited, to specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH.sub.4; acetylation, formylation, oxidation, reduction; metabolic synthesis in the presence of tunicamycin; and the like.

[0098] Additional post-translational modifications include, for example, N-linked or O-linked carbohydrate chains, processing of N-terminal or C-terminal ends), attachment of chemical moieties to the amino acid backbone, chemical modifications of N-linked or O-linked carbohydrate chains, and addition or deletion of an N-terminal methionine residue as a result of prokaryotic host cell expression. The polypeptide fragments may also be modified with a detectable label, such as an enzymatic, fluorescent, isotopic or affinity label to allow for detection and isolation of the polypeptide.

[0099] Also provided are chemically modified polypeptide derivatives that may provide additional advantages such as increased solubility, stability and circulating time of the polypeptide, or decreased immunogenicity. See U.S. Pat. No. 4,179,337. The chemical moieties for derivitization may be selected from water soluble polymers such as polyethylene glycol, ethylene glycol/propylene glycol copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol and the like. The polypeptides may be modified at random positions within the molecule, or at predetermined positions within the molecule and may include one, two, three or more attached chemical moieties.

[0100] The polymer may be of any molecular weight, and may be branched or unbranched. For polyethylene glycol, the molecular weight is between about 1 kDa and about 100 kDa (the term "about" indicating that in preparations of polyethylene glycol, some molecules will weigh more, some less, than the stated molecular weight) for ease in handling and manufacturing. Other sizes may be used, depending on the desired therapeutic profile (e.g., the duration of sustained release desired, the effects, if any on biological activity, the ease in handling, the degree or lack of antigenicity and other known effects of the polyethylene glycol to a therapeutic protein or analog).

[0101] The polyethylene glycol molecules (or other chemical moieties) should be attached to the polypeptide with consideration of effects on functional or antigenic domains of the polypeptide. There are a number of attachment methods available to those skilled in the art, e.g., EP 0 401 384, herein incorporated by reference (coupling PEG to G-CSF), see also Malik et al. (1992) Exp Hematol. September; 20 (8): 1028-35, reporting pegylation of GM-CSF using tresyl chloride). For example, polyethylene glycol may be covalently bound through amino acid residues via a reactive group, such as, a free amino or carboxyl group. Reactive groups are those to which an activated polyethylene glycol molecule may be bound. The amino acid residues having a free amino group may include lysine residues and the N-terminal amino acid residues; those having a free carboxyl group may include aspartic acid residues, glutamic acid residues and the C-terminal amino acid residue. Sulfhydryl groups may also be used as a reactive group for attaching the polyethylene glycol molecules. A polymer sometimes is attached at an amino group, such as attachment at the N-terminus or lysine group.

[0102] One may specifically desire proteins chemically modified at the N-terminus. Using polyethylene glycol as an illustration of the present composition, one may select from a variety of polyethylene glycol molecules (by molecular weight, branching, and the like), the proportion of polyethylene glycol molecules to protein (polypeptide) molecules in the reaction mix, the type of pegylation reaction to be performed, and the method of obtaining the selected N-terminally pegylated protein. The method of obtaining the N-terminally pegylated preparation (i.e., separating this moiety from other monopegylated moieties if necessary) may be by purification of the N-terminally pegylated material from a population of pegylated protein molecules. Selective proteins chemically modified at the N-terminus may be accomplished by reductive alkylation, which exploits differential reactivity of different types of primary amino groups (lysine versus the N-terminal) available for derivatization in a particular protein. Under the appropriate reaction conditions, substantially selective derivatization of the protein at the N-terminus with a carbonyl group containing polymer is achieved.

[0103] Substantially Identical Nucleic Acids and Polypeptides

[0104] Nucleotide sequences and polypeptide sequences that are substantially identical to a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleotide sequence and the ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide sequences encoded by those nucleotide sequences are included herein. The term "substantially identical" as used herein refers to two or more nucleic acids or polypeptides sharing one or more identical nucleotide sequences or polypeptide sequences, respectively. Included are nucleotide sequences or polypeptide sequences that are 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more (each often within a 1%, 2%, 3% or 4% variability) or more identical to the nucleotide sequences in SEQ ID NO: 1-17 or the encoded ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide amino acid sequences. One test for determining whether two nucleic acids are substantially identical is to determine the percent of identical nucleotide sequences or polypeptide sequences shared between the nucleic acids or polypeptides.

[0105] Calculations of sequence identity are often performed as follows. Sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). The length of a reference sequence aligned for comparison purposes is sometimes 30% or more, 40% or more, 50% or more, often 60% or more, and more often 70% or more, 80% or more, 90% or more, 90% or more, or 100% of the length of the reference sequence. The nucleotides or amino acids at corresponding nucleotide or polypeptide positions, respectively, are then compared among the two sequences. When a position in the first sequence is occupied by the same nucleotide or amino acid as the corresponding position in the second sequence, the nucleotides or amino acids are deemed to be identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, introduced for optimal alignment of the two sequences.

[0106] Comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. Percent identity between two amino acid or nucleotide sequences can be determined using the algorithm of Meyers & Miller, CABIOS 4: 11-17 (1989), which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. Also, percent identity between two amino acid sequences can be determined using the Needleman & Wunsch, J. Mol. Biol. 48: 444-453 (1970) algorithm which has been incorporated into the GAP program in the GCG software package (available at the http address www.gcg.com), using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6. Percent identity between two nucleotide sequences can be determined using the GAP program in the GCG software package (available at http address www.gcg.com), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6. A set of parameters often used is a Blossum 62 scoring matrix with a gap open penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.

[0107] Another manner for determining if two nucleic acids are substantially identical is to assess whether a polynucleotide homologous to one nucleic acid will hybridize to the other nucleic acid under stringent conditions. As use herein, the term "stringent conditions" refers to conditions for hybridization and washing. Stringent conditions are known to those skilled in the art and can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y., 6.3.1-6.3.6 (1989). Aqueous and non-aqueous methods are described in that reference and either can be used. An example of stringent hybridization conditions is hybridization in 6.times. sodium chloride/sodium citrate (SSC) at about 45.degree. C., followed by one or more washes in 0.2.times.SSC, 0.1% SDS at 50.degree. C. Another example of stringent hybridization conditions are hybridization in 6.times. sodium chloride/sodium citrate (SSC) at about 45.degree. C., followed by one or more washes in 0.2.times.SSC, 0.1% SDS at 55.degree. C. A further example of stringent hybridization conditions is hybridization in 6.times. sodium chloride/sodium citrate (SSC) at about 45.degree. C., followed by one or more washes in 0.2.times.SSC, 0.1% SDS at 60.degree. C. Often, stringent hybridization conditions are hybridization in 6.times. sodium chloride/sodium citrate (SSC) at about 45.degree. C., followed by one or more washes in 0.2.times.SSC, 0.1% SDS at 65.degree. C. More often, stringency conditions are 0.5M sodium phosphate, 7% SDS at 65.degree. C., followed by one or more washes at 0.2.times.SSC, 1% SDS at 65.degree. C.

[0108] An example of a substantially identical nucleotide sequence to a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleotide sequence is one that has a different nucleotide sequence but still encodes the same polypeptide sequence encoded by the ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleotide sequence. Another example is a nucleotide sequence that encodes a polypeptide having a polypeptide sequence that is more than 70% or more identical to, sometimes 75% or more, 80% or more, or 85% or more identical to, and often 90% or more and 95% or more identical to a polypeptide sequence encoded by a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleotide sequence.

[0109] ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleotide sequences and ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 amino acid sequences can be used as "query sequences" to perform a search against public databases to identify other family members or related sequences, for example. Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul et al., J. Mol. Biol. 215: 403-10 (1990). BLAST nucleotide searches can be performed with the NBLAST program, score=100, wordlength=12 to obtain nucleotide sequences homologous to nucleotide sequences from SEQ ID NO: 1-17. BLAST polypeptide searches can be performed with the XBLAST program, score=50, wordlength=3 to obtain amino acid sequences homologous to polypeptides encoded by a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleotide sequence. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., Nucleic Acids Res. 25(17): 3389-3402 (1997). When utilizing BLAST and Gapped BLAST programs, default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used (see the http address www.ncbi.nlm.nih.gov).

[0110] A nucleic acid that is substantially identical to a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleotide sequence may include polymorphic sites at positions equivalent to those described herein when the sequences are aligned. For example, using the alignment procedures described herein, SNPs in a sequence substantially identical to a sequence in SEQ ID NO: 1-17 can be identified at nucleotide positions that match (i.e., align) with nucleotides at SNP positions in the nucleotide sequence of SEQ ID NO: 1-17. Also, where a polymorphic variation results in an insertion or deletion, insertion or deletion of a nucleotide sequence from a reference sequence can change the relative positions of other polymorphic sites in the nucleotide sequence.

[0111] Substantially identical nucleotide and polypeptide sequences include those that are naturally occurring, such as allelic variants (same locus), splice variants, homologs (different locus), and orthologs (different organism) or can be non-naturally occurring. Non-naturally occurring variants can be generated by mutagenesis techniques, including those applied to polynucleotides, cells, or organisms. The variants can contain nucleotide substitutions, deletions, inversions and insertions. Variation can occur in either or both the coding and non-coding regions. The variations can produce both conservative. and non-conservative amino acid substitutions (as compared in the encoded product). Orthologs, homologs, allelic variants, and splice variants can be identified using methods known in the art. These variants normally comprise a nucleotide sequence encoding a polypeptide that is 50% or more, about 55% or more, often about 70-75% or more, more often about 80-85% or more, and typically about 90-95% or more identical to the amino acid sequences of target polypeptides or a fragment thereof. Such nucleic acid molecules readily can be identified as being able to hybridize under stringent conditions to a nucleotide sequence in SEQ ID NO: 1-17 or a fragment thereof. Nucleic acid molecules corresponding to orthologs, homologs, and allelic variants of a nucleotide sequence in SEQ ID NO: 1-17 can be identified by mapping the sequence to the same chromosome or locus as the nucleotide sequence in SEQ ID NO: 1-17.

[0112] Also, substantially identical nucleotide sequences may include codons that are altered with respect to the naturally occurring sequence for enhancing expression of a target polypeptide in a particular expression system. For example, the nucleic acid can be one in which one or more codons are altered, and often 10% or more or 20% or more of the codons are altered for optimized expression in bacteria (e.g., E. coli), yeast (e.g., S. cervesiae), human (e.g., 293 cells), insect, or rodent (e.g., hamster) cells.

[0113] Methods for Identifying Subjects at Risk of Breast Cancer and Breast Cancer Risk in a Subject

[0114] Methods for prognosing and diagnosing breast cancer in subjects are provided herein. These methods include detecting the presence or absence of one or more polymorphic variations associated with breast cancer in a nucleotide sequence set forth in SEQ ID NO: 1-7, or substantially identical sequence thereof, in a sample from a subject, where the presence of a polymorphic variant is indicative of a risk of breast cancer.

[0115] Thus, featured herein is a method for detecting a subject at risk of breast cancer or the risk of breast cancer in a subject, which comprises detecting the presence or absence of a polymorphic variation associated with breast cancer at a polymorphic site in a nucleic acid sample from a subject, where the nucleotide sequence comprises a polynucleotide sequence selected from the group consisting of: (a) a nucleotide sequence set forth in SEQ ID NO: 1-7; (b) a nucleotide sequence which encodes a polypeptide having an amino acid sequence encoded by a nucleotide sequence in SEQ ID NO: 1-7; (c) a nucleotide sequence which encodes a polypeptide that is 90% or more identical to an amino acid sequence encoded by a nucleotide sequence in SEQ ID NO: 1-7 or a nucleotide sequence about 90% or more identical to the nucleotide sequence set forth in SEQ ID NO: 1-7; and (d) a fragment of a nucleotide sequence of (a), (b), or (c), often a fragment that includes a polymorphic site associated with breast cancer; whereby the presence of the polymorphic variation is indicative of a risk of breast cancer in the subject. In certain embodiments, the polymorphic variant is detected at a position described herein. The term "SEQ ID NO: 1-7" as used herein refers to one or more of SEQ ID NO: 1, 2, 3, 4, 5, 6 or 7.

[0116] In certain embodiments, determining the presence of a combination of two or more polymorphic variants associated with breast cancer in one or more genetic loci (e.g., one or more genes) of the sample is determined to identify, quantify and/or estimate, risk of breast cancer. The risk often is the probability of having or developing breast cancer. The risk sometimes is expressed as a relative risk with respect to a population average risk of breast cancer, and sometimes is expressed as a relative risk with resepect to the lowest risk group. Such relative risk assessments often are based upon penetrance values determined by statistical methods (see e.g., statistical analysis Example 9), and are particularly useful to clinicians and insurance companies for assessing risk of breast cancer (e.g., a clinician can target appropriate detection, prevention and therapeutic regimens to a partient after determining the patient's risk of breast cancer, and an insurance company can fine tune actuarial tables based upon population genotype assessments of breast cancer risk). Risk of breast cancer sometimes is expressed as an odds ratio, which is the odds of a particular person having a genotype has or will develop breast cancer with respect to another genotype group (e.g., the most disease protective genotype or population average). In related embodiments, the determination is utilized to identify a subject at risk of breast cancer. In an embodiment, two or more polymorphic variations are detected in two or more regions in human genomic DNA associated with increased risk of breast cancer, such as regions selected from the group of loci consisting of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 and LOC145197, for example. In certain embodiments, 3 or more, or 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 or more polymorphic variants are detected in the sample. In specific embodiments, polymorphic variants are detected in ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 and LOC145197 loci, such as at positions 44247 in SEQ ID NO: 1 (ICAM), position 36424 in SEQ ID NO: 2 (MAPK10), position 48563 in SEQ ID NO: 3 (KIAA0861), position 49002 in SEQ ID NO: 4 (NUMA1) and position 174 in SEQ ID NO: 5 (GALE), for example. In certain embodiments, polymorphic variants are detected at other genetic loci (e.g., the polymorphic variants can be detected in ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 and/or LOC145197 in addition to other loci or only in other loci), where the other loci include but are not limited to RAD21, KLF12, SPUVE, GRIN3A, PFTK1, SERPINA5, LOC115209, HRMT1L3, DLG1, KIAA0783, DPF3, CENPC1, GP6, LAMA4, CHCB/C20ORF154, LOC338749, and TTN/LOC351327, which are described in patent applications Nos. 10/723,670, 10/723,518, 10/722,939 and 10/723,683, having attorney docket numbers524592006700, 524592006800, 524592007100 and 524592007200, respectively, and any others disclosed in patent application Nos. 60/429,136 (filed Nov. 25, 2002) and 60/490,234 (filed Jul. 24, 2003).

[0117] A risk of developing aggressive forms of breast cancer likely to metastasize or invade surrounding tissues (e.g., Stage IIIA, IIIB, and IV breast cancers), and subjects at risk of developing aggressive forms of breast cancer also may be identified by the methods described herein. These methods include collecting phenotype information from subjects having breast cancer, which includes the stage of progression of the breast cancer, and performing a secondary phenotype analysis to detect the presence or absence of one or more polymorphic variations associated with a particular stage form of breast cancer. Thus, detecting the presence or absence of one or more polymorphic variations in a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleotide sequence associated with a late stage form of breast cancer often is prognostic and/or diagnostic of an aggressive form of the cancer.

[0118] Results from prognostic tests may be combined with other test results to diagnose breast cancer. For example, prognostic results may be gathered, a patient sample may be ordered based on a determined predisposition to breast cancer, the patient sample is analyzed, and the results of the analysis may be utilized to diagnose breast cancer. Also breast cancer diagnostic methods can be developed from studies used to generate prognostic/diagnostic methods in which populations are stratified into subpopulations having different progressions of breast cancer. In another embodiment, prognostic results may be gathered; a patient's risk factors for developing breast cancer analyzed (e.g., age, race, family history, age of first menstrual cycle, age at birth of first child); and a patient sample may be ordered based on a determined predisposition to breast cancer. In an alternative embodiment, the results from predisposition analyses described herein may be combined with other test results indicative of breast cancer, which were previously, concurrently, or subsequently gathered with respect to the predisposition testing. In these embodiments, the combination of the prognostic test results with other test results can be probative of breast cancer, and the combination can be utilized as a breast cancer diagnostic. The results of any test indicative of breast cancer known in the art may be combined with the methods described herein. Examples of such tests are mammography (e.g., a more frequent and/or earlier mammography regimen may be prescribed); breast biopsy and optionally a biopsy from another tissue; breast ultrasound and optionally an ultrasound analysis of another tissue; breast magnetic resonance imaging (MRI) and optionally an MRI analysis of another tissue; electrical impedance (T-scan) analysis of breast and optionally of another tissue; ductal lavage; nuclear medicine analysis (e.g., scintimammography); BRCA1 and/or BRCA2 sequence analysis results; and thermal imaging of the breast and optionally of another tissue. Testing may be performed on tissue other than breast to diagnose the occurrence of metastasis (e.g., testing of the lymph node).

[0119] Risk of breast cancer sometimes is expressed as a probability, such as an odds ratio, percentage, or risk factor. The risk is based upon the presence or absence of one or more polymorphic variants described herein, and also may be based in part upon phenotypic traits of the individual being tested. Methods for calculating predispositions based upon patient data are well known (see, e.g., Agresti, Categorical Data Analysis, 2nd Ed. 2002. Wiley). Allelotyping and genotyping analyses may be carried out in populations other than those exemplified herein to enhance the predictive power of the prognostic method. These further analyses are executed in view of the exemplified procedures described herein, and may be based upon the same polymorphic variations or additional polymorphic variations. Risk determinations for breast cancer are useful in a variety of applications. In one embodiment, breast cancer risk determinations are used by clinicians to direct appropriate detection, preventative and treatment procedures to subjects who most require these. In another embodiment, breast cancer risk determinations are used by health insurers for preparing actuarial tables and for calculating insurance premiums.

[0120] The nucleic acid sample typically is isolated from a biological sample obtained from a subject. For example, nucleic acid can be isolated from blood, saliva, sputum, urine, cell scrapings, and biopsy tissue. The nucleic acid sample can be isolated from a biological sample using standard techniques, such as the technique described in Example 2. As used herein, the term "subject" refers primarily to humans but also refers to other mammals such as dogs, cats, and ungulates (e.g., cattle, sheep, and swine). Subjects also include avians (e.g., chickens and turkeys), reptiles, and fish (e.g., salmon), as embodiments described herein can be adapted to nucleic acid samples isolated from any of these organisms. The nucleic acid sample may be isolated from the subject and then directly utilized in a method for determining the presence of a polymorphic variant, or alternatively, the sample may be isolated and then stored (e.g., frozen) for a period of time before being subjected to analysis.

[0121] The presence or absence of a polymorphic variant is determined using one or both chromosomal complements represented in the nucleic acid sample. Determining the presence or absence of a polymorphic variant in both chromosomal complements represented in a nucleic acid sample from a subject having a copy of each chromosome is useful for determining the zygosity of an individual for the polymorphic variant (i.e., whether the individual is homozygous or heterozygous for the polymorphic variant). Any oligonucleotide-based diagnostic may be utilized to determine whether a sample includes the presence or absence of a polymorphic variant in a sample. For example, primer extension methods, ligase sequence determination methods (e.g., U.S. Pat. Nos. 5,679,524 and 5,952,174, and WO 01/27326), mismatch sequence determination methods (e.g., U.S. Pat. Nos. 5,851,770; 5,958,692; 6,110,684; and 6,183,958), microarray sequence determination methods, restriction fragment length polymorphism (RFLP), single strand conformation polymorphism detection (SSCP) (e.g., U.S. Pat. Nos. 5,891,625 and 6,013,499), PCR-based assays (e.g., TAQMAN.RTM. PCR System (Applied Biosystems)), and nucleotide sequencing methods may be used.

[0122] Oligonucleotide extension methods typically involve providing a pair of oligonucleotide primers in a polymerase chain reaction (PCR) or in other nucleic acid amplification methods for the purpose of amplifying a region from the nucleic acid sample that comprises the polymorphic variation. One oligonucleotide primer is complementary to a region 3' of the polymorphism and the other is complementary to a region 5' of the polymorphism. A PCR primer pair may be used in methods disclosed in U.S. Pat. Nos. 4,683,195; 4,683,202, 4,965,188; 5,656,493; 5,998,143; 6,140,054; WO 01/27327; and WO 01/27329 for example. PCR primer pairs may also be used in any commercially available machines that perform PCR, such as any of the GENEAMP.RTM. Systems available from Applied Biosystems. Also, those of ordinary skill in the art will be able to design oligonucleotide primers based upon a nucleotide sequence set forth in SEQ ID NO: 1-7 without undue experimentation using knowledge readily available in the art.

[0123] Also provided is an extension oligonucleotide that hybridizes to the amplified fragment adjacent to the polymorphic variation. As used herein, the term "adjacent" refers to the 3' end of the extension oligonucleotide being often 1 nucleotide from the 5' end of the polymorphic site, and sometimes 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides from the 5' end of the polymorphic site, in the nucleic acid when the extension oligonucleotide is hybridized to the nucleic acid. The extension oligonucleotide then is extended by one or more nucleotides, and the number and/or type of nucleotides that are added to the extension oligonucleotide determine whether the polymorphic variant is present. Oligonucleotide extension methods are disclosed, for example, in U.S. Pat. Nos. 4,656,127; 4,851,331; 5,679,524; 5,834,189; 5,876,934; 5,908,755; 5,912,118; 5,976,802; 5,981,186; 6,004,744; 6,013,431; 6,017,702; 6,046,005; 6,087,095; 6,210,891; and WO 01/20039. Oligonucleotide extension methods using mass spectrometry are described, for example, in U.S. Pat. Nos. 5,547,835; 5,605,798; 5,691,141; 5,849,542; 5,869,242; 5,928,906; 6,043,031; and 6,194,144, and a method often utilized is described herein in Example 2. Multiple extension oligonucleotides may be utilized in one reaction, which is referred to herein as "multiplexing."

[0124] A microarray can be utilized for determining whether a polymorphic variant is present or absent in a nucleic acid sample. A microarray may include any oligonucleotides described herein, and methods for making and using oligonucleotide microarrays suitable for diagnostic use are disclosed in U.S. Pat. Nos. 5,492,806; 5,525,464; 5,589,330; 5,695,940; 5,849,483; 6,018,041; 6,045,996; 6,136,541; 6,142,681; 6,156,501; 6,197,506; 6,223,127; 6,225,625; 6,229,911; 6,239,273; WO 00/52625; WO 01/25485; and WO 01/29259. The microarray typically comprises a solid support and the oligonucleotides may be linked to this solid support by covalent bonds or by non-covalent interactions. The oligonucleotides may also be linked to the solid support directly or by a spacer molecule. A microarray may comprise one or more oligonucleotides complementary to a polymorphic site set forth in SEQ ID NO: 1-7 or below.

[0125] A kit also may be utilized for determining whether a polymorphic variant is present or absent in a nucleic acid sample. A kit often comprises one or more pairs of oligonucleotide primers useful for amplifying a fragment of a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleotide sequence or a substantially identical sequence thereof, where the fragment includes a polymorphic site. The kit sometimes comprises a polymerizing agent, for example, a thermostable nucleic acid polymerase such as one disclosed in U.S. Pat. No. 4,889,818 or 6,077,664. Also, the kit often comprises an elongation oligonucleotide that hybridizes to a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleotide sequence in a nucleic acid sample adjacent to the polymorphic site. Where the kit includes an elongation oligonucleotide, it also often comprises chain elongating nucleotides, such as dATP, dTTP, dGTP, dCTP, and dTTP, including analogs of dATP, dTTP, dGTP, dCTP and dTTP, provided that such analogs are substrates for a thermostable nucleic acid polymerase and can be incorporated into a nucleic acid chain elongated from the extension oligonucleotide. Along with chain elongating nucleotides would be one or more chain terminating nucleotides such as ddATP, ddTTP, ddGTP, ddCTP, and the like. In an embodiment, the kit comprises one or more oligonucleotide primer pairs, a polymerizing agent, chain elongating nucleotides, at least one elongation oligonucleotide, and one or more chain terminating nucleotides. Kits optionally include buffers, vials, microtiter plates, and instructions for use.

[0126] An individual identified as being at risk of breast cancer may be heterozygous or homozygous with respect to the allele associated with a higher risk of breast cancer. A subject homozygous for an allele associated with an increased risk of breast cancer is at a comparatively high risk of breast cancer, a subject heterozygous for an allele associated with an increased risk of breast cancer is at a comparatively intermediate risk of breast cancer, and a subject homozygous for an allele associated with a decreased risk of breast cancer is at a comparatively low risk of breast cancer. A genotype may be assessed for a complementary strand, such that the complementary nucleotide at a particular position is detected.

[0127] Also featured are methods for determining risk of breast cancer and/or identifying a subject at risk of breast cancer by contacting a polypeptide or protein encoded by a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleotide sequence from a subject with an antibody that specifically binds to an epitope associated with increased risk of breast cancer in the polypeptide. In certain embodiments, the antibody specifically binds to an epitope that comprises a leucine at amino acid position 359 in SEQ ID NO: 23, a leucine at amino acid position 378 in SEQ ID NO: 23, an alanine at amino acid position 857 in SEQ ID NO: 23, an alanine at position 902 in SEQ ID NO: 23 a proline at amino acid position 352 in SEQ ID NO: 20 or an alanine at amino acid position 348 in SEQ ID NO: 20.

[0128] Applications of Prognostic and Diagnostic Results to Pharmacogenomic Methods

[0129] Pharmacogenomics is a discipline that involves tailoring a treatment for a subject according to the subject's genotype. For example, based upon the outcome of a prognostic test described herein, a clinician or physician may target pertinent information and preventative or therapeutic treatments to a subject who would be benefited by the information or treatment and avoid directing such information and treatments to a subject who would not be benefited (e.g., the treatment has no therapeutic effect and/or the subject experiences adverse side effects). As therapeutic approaches for breast cancer continue to evolve and improve, the goal of treatments for breast cancer related disorders is to intervene even before clinical signs (e.g., identification of lump in the breast) first manifest. Thus, genetic markers associated with susceptibility to breast cancer prove useful for early diagnosis, prevention and treatment of breast cancer.

[0130] The following is an example of a pharmacogenomic embodiment. A particular treatment regimen can exert a differential effect depending upon the subject's genotype. Where a candidate therapeutic exhibits a significant interaction with a major allele and a comparatively weak interaction with a minor allele (e.g., an order of magnitude or greater difference in the interaction), such a therapeutic typically would not be administered to a subject genotyped as being homozygous for the minor allele, and sometimes not administered to a subject genotyped as being heterozygous for the minor allele. In another example, where a candidate therapeutic is not significantly toxic when administered to subjects who are homozygous for a major allele but is comparatively toxic when administered to subjects heterozygous or homozygous for a minor allele, the candidate therapeutic is not typically administered to subjects who are genotyped as being heterozygous or homozygous with respect to the minor allele.

[0131] The methods described herein are applicable to pharmacogenomic methods for detecting, preventing, alleviating and/or treating breast cancer. For example, a nucleic acid sample from an individual may be subjected to a genetic test described herein. Where one or more polymorphic variations associated with increased risk of breast cancer are identified in a subject, information for detecting, preventing or treating breast cancer and/or one or more breast cancer detection, prevention and/or treatment regimens then may be directed to and/or prescribed to that subject.

[0132] In certain embodiments, a detection, prevenative and/or treatment regimen is specifically prescribed and/or administered to individuals who will most benefit from it based upon their risk of developing breast cancer assessed by the methods described herein. Thus, provided are methods for identifying a subject at risk of breast cancer and then prescribing a detection, therapeutic or preventative regimen to individuals identified as being at risk of breast cancer. Thus, certain embodiments are directed to methods for treating breast cancer in a subject, reducing risk of breast cancer in a subject, or early detection of breast cancer in a subject, which comprise: detecting the presence or absence of a polymorphic variant associated with breast cancer in a nucleotide sequence in a nucleic acid sample from a subject, where the nucleotide sequence comprises a polynucleotide sequence selected from the group consisting of: (a) a nucleotide sequence set forth in SEQ ID NO: 1-7; (b) a nucleotide sequence which encodes a polypeptide having an amino acid sequence encoded by a nucleotide sequence in SEQ ID NO: 1-7; (c) a nucleotide sequence which encodes a polypeptide that is 90% or more identical to an amino acid sequence encoded by a nucleotide sequence in SEQ ID NO: 1-7 or a nucleotide sequence about 90% or more identical to the nucleotide sequence set forth in SEQ ID NO: 1-7; and (d) a fragment of a nucleotide sequence of (a), (b), or (c), sometimes comprising a polymorphic site associated with breast cancer; and prescribing or administering a breast cancer treatment regimen, preventative regimen and/or detection regimen to a subject from whom the sample originated where the presence of one or more polymorphic variations associated with breast cancer are detected in the nucleotide sequence. In these methods, genetic results may be utilized in combination with other test results to diagnose breast cancer as described above. Other test results include but are not limited to mammography results, imaging results, biopsy results and results from BRCA1 or BRAC2 test results, as described above.

[0133] Detection regimens include one or more mammography procedures, a regular mammography regimen (e.g., once a year, or once every six, four, three or two months); an early mammography regimen (e.g., mammography tests are performed beginning at age 25, 30, or 35); one or more biopsy procedures (e.g., a regular biopsy regimen beginning at age 40); breast biopsy and biopsy from other tissue; breast ultrasound and optionally ultrasound analysis of another tissue; breast magnetic resonance imaging (MRI) and optionally MRI analysis of another tissue; electrical impedance (T-scan) analysis of breast and optionally another tissue; ductal lavage; nuclear medicine analysis (e.g., scintimammography); BRCA1 and/or BRCA2 sequence analysis results; and/or thermal imaging of the breast and optionally another tissue.

[0134] Treatments sometimes are preventative (e.g., is prescribed or administered to reduce the probability that a breast cancer associated condition arises or progresses), sometimes are therapeutic, and sometimes delay, alleviate or halt the progression of breast cancer. Any known preventative or therapeutic treatment for alleviating or preventing the occurrence of breast cancer is prescribed and/or administered. For example, certain preventative treatments often are prescribed to subjects having a predisposition to breast cancer and where the subject is not diagnosed with breast cancer or is diagnosed as having symptoms indicative of early stage breast cancer (e.g., stage I). For subjects not diagnosed as having breast cancer, any preventative treatments known in the art can be prescribed and administered, which include selective hormone receptor modulators (e.g., selective estrogen receptor modulators (SERMs) such as tamoxifen, reloxifene, and toremifene); compositions that prevent production of hormones (e.g., aramotase inhibitors that prevent the production of estrogen in the adrenal gland, such as exemestane, letrozole, anastrozol, groserelin, and megestrol); other hormonal treatments (e.g., goserelin acetate and fulvestrant); biologic response modifiers such as antibodies (e.g., trastuzumab (herceptin/HER2)); surgery (e.g., lumpectomy and mastectomy); drugs that delay or halt metastasis (e.g., pamidronate disodium); and alternative/complementary medicine (e.g., acupuncture, acupressure, moxibustion, qi gong, reiki, ayurveda, vitamins, minerals, and herbs (e.g., astragalus root, burdock root, garlic, green tea, and licorice root)).

[0135] The use of breast cancer treatments are well known in the art, and include surgery, chemotherapy and/or radiation therapy. Any of the treatments may be used in combination to treat or prevent breast cancer (e.g., surgery followed by radiation therapy or chemotherapy). Examples of chemotherapeutics are taxanes (e.g., docetaxel or paclitaxel), and examples of chemotherapy combinations used to treat breast cancer include: cyclophosphamide (Cytoxan), methotrexate (Amethopterin, Mexate, Folex), and fluorouracil (Fluorouracil, 5-Fu, Adrucil), which is referred to as CMF; cyclophosphamide, doxorubicin (Adriamycin), and fluorouracil, which is referred to as CAF; and doxorubicin (Adriamycin) and cyclophosphamide, which is referred to as AC.

[0136] As breast cancer preventative and treatment information can be specifically targeted to subjects in need thereof (e.g., those at risk of developing breast cancer or those that have early signs of breast cancer), provided herein is a method for preventing or reducing the risk of developing breast cancer in a subject, which comprises: (a) detecting the presence or absence of a polymorphic variation associated with breast cancer at a polymorphic site in a nucleotide sequence in a nucleic acid sample from a subject; (b) identifying a subject with a predisposition to breast cancer, whereby the presence of the polymorphic variation is indicative of a predisposition to breast cancer in the subject; and (c) if such a predisposition is identified, providing the subject with information about methods or products to prevent or reduce breast cancer or to delay the onset of breast cancer. Also provided is a method of targeting information or advertising to a subpopulation of a human population based on the subpopulation being genetically predisposed to a disease or condition, which comprises: (a) detecting the presence or absence of a polymorphic variation associated with breast cancer at a polymorphic site in a nucleotide sequence in a nucleic acid sample from a subject; (b) identifying the subpopulation of subjects in which the polymorphic variation is associated with breast cancer; and (c) providing information only to the subpopulation of subjects about a particular product which may be obtained and consumed or applied by the subject to help prevent or delay onset of the disease or condition.

[0137] Pharmacogenomics methods also may be used to analyze and predict a response to a breast cancer treatment or a drug. For example, if pharmacogenomics analysis indicates a likelihood that an individual will respond positively to a breast cancer treatment with a particular drug, the drug may be administered to the individual. Conversely, if the analysis indicates that an individual is likely to respond negatively to treatment with a particular drug, an alternative course of treatment may be prescribed. A negative response may be defined as either the absence of an efficacious response or the presence of toxic side effects. The response to a therapeutic treatment can be predicted in a background study in which subjects in any of the following populations are genotyped: a population that responds favorably to a treatment regimen, a population that does not respond significantly to a treatment regimen, and a population that responds adversely to a treatment regiment (e.g., exhibits one or more side effects). These populations are provided as examples and other populations and subpopulations may be analyzed. Based upon the results of these analyses, a subject is genotyped to predict whether he or she will respond favorably to a treatment regimen, not respond significantly to a treatment regimen, or respond adversely to a treatment regimen.

[0138] The methods described herein also are applicable to clinical drug trials. One or more polymorphic variants indicative of response to an agent for treating breast cancer or to side effects to an agent for treating breast cancer may be identified using the methods described herein. Thereafter, potential participants in clinical trials of such an agent may be screened to identify those individuals most likely to respond favorably to the drug and exclude those likely to experience side effects. In that way, the effectiveness of drug treatment may be measured in individuals who respond positively to the drug, without lowering the measurement as a result of the inclusion of individuals who are unlikely to respond positively in the study and without risking undesirable safety problems. In certain embodiments, the agent for treating breast cancer described herein targets ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 or a target in the ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 pathway.

[0139] Thus, another embodiment is a method of selecting an individual for inclusion in a clinical trial of a treatment or drug comprising the steps of: (a) obtaining a nucleic acid sample from an individual; (b) determining the identity of a polymorphic variation which is associated with a positive response to the treatment or the drug, or at least one polymorphic variation which is associated with a negative response to the treatment or the drug in the nucleic acid sample, and (c) including the individual in the clinical trial if the nucleic acid sample contains said polymorphic variation associated with a positive response to the treatment or the drug or if the nucleic acid sample lacks said polymorphic variation associated with a negative response to the treatment or the drug. In addition, the methods for selecting an individual for inclusion in a clinical trial of a treatment or drug encompass methods with any further limitation described in this disclosure, or those following, specified alone or in any combination. The polymorphic variation may be in a sequence selected individually or in any combination from the group consisting of (i) a polynucleotide sequence set forth in SEQ ID NO: 1-7; (ii) a polynucleotide sequence that is 90% or more identical to a nucleotide sequence set forth in SEQ ID NO: 1-7; (iii) a polynucleotide sequence that encodes a polypeptide having an amino acid sequence identical to or 90% or more identical to an amino acid sequence encoded by a nucleotide sequence set forth in SEQ ID NO: 1-7; and (iv) a fragment of a polynucleotide sequence of (i), (ii), or (iii) comprising the polymorphic site. The including step (c) optionally comprises administering the drug or the treatment to the individual if the nucleic acid sample contains the polymorphic variation associated with a positive response to the treatment or the drug and the nucleic acid sample lacks said biallelic marker associated with a negative response to the treatment or the drug.

[0140] Also provided herein is a method of partnering between a diagnostic/prognostic testing provider and a provider of a consumable product, which comprises: (a) the diagnostic/prognostic testing provider detects the presence or absence of a polymorphic variation associated with breast cancer at a polymorphic site in a nucleotide sequence in a nucleic acid sample from a subject; (b) the diagnostic/prognostic testing provider identifies the subpopulation of subjects in which the polymorphic variation is associated with breast cancer; (c) the diagnostic/prognostic testing provider forwards information to the subpopulation of subjects about a particular product which may be obtained and consumed or applied by the subject to help prevent or delay onset of the disease or condition; and (d) the provider of a consumable product forwards to the diagnostic test provider a fee every time the diagnostic/prognostic test provider forwards information to the subject as set forth in step (c) above.

[0141] Compositions Comprising Breast Cancer-Directed Molecules

[0142] Featured herein is a composition comprising a breast cancer cell and one or more molecules specifically directed and targeted to a nucleic acid comprising a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleotide sequence or a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide. Such directed molecules include, but are not limited to, a compound that binds to a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleic acid or a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide; a RNA1 or siRNA molecule having a strand complementary to a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleotide sequence; an antisense nucleic acid complementary to an RNA encoded by a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 DNA sequence; a ribozyme that hybridizes to a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleotide sequence; a nucleic acid aptamer that specifically binds a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide; and an antibody that specifically binds to a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide or binds to a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleic acid. In certain embodiments, the antibody specifically binds to an epitope that comprises a leucine at amino acid position 359 in SEQ ID NO: 23, a leucine at amino acid position 378 in SEQ ID NO: 23, an alanine at amino acid position 857 in SEQ ID NO: 23, an alanine at position 902 in SEQ ID NO: 23 a proline at amino acid position 352 in SEQ ID NO: 20 or an alanine at amino acid position 348 in SEQ ID NO: 20. In specific embodiments, the breast cancer directed molecule interacts with a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleic acid or polypeptide variant associated with breast cancer. In other embodiments, the breast cancer directed molecule interacts with a polypeptide involved in the ICAM, MAPK10, KIAA 0861, NUMA1, GALE, DPF3 or LOC145197 signal pathway, or a nucleic acid encoding such a polypeptide. Polypeptides involved in the ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 signal pathway are discussed herein.

[0143] Compositions sometimes include an adjuvant known to stimulate an immune response, and in certain embodiments, an adjuvant that stimulates a T-cell lymphocyte response. Adjuvants are known, including but not limited to an aluminum adjuvant (e.g., aluminum hydroxide); a cytokine adjuvant or adjuvant that stimulates a cytokine response (e.g., interleukin (IL)-12 and/or gamma-interferon cytokines); a Freund-type mineral oil adjuvant emulsion (e.g., Freund's complete or incomplete adjuvant); a synthetic lipoid compound; a copolymer adjuvant (e.g., TitreMax); a saponin; Quil A; a liposome; an oil-in-water emulsion (e.g., an emulsion stabilized by Tween 80 and pluronic polyoxyethlene/polyoxypro- pylene block copolymer (Syntex Adjuvant Formulation); TitreMax; detoxified endotoxin (MPL) and mycobacterial cell wall components (TDW, CWS) in 2% squalene (Ribi Adjuvant System)); a muramyl dipeptide; an immune-stimulating complex (ISCOM, e.g., an Ag-modified saponin/cholesterol micelle that forms stable cage-like structure); an aqueous phase adjuvant that does not have a depot effect (e.g., Gerbu adjuvant); a carbohydrate polymer (e.g., AdjuPrime); L-tyrosine; a manide-oleate compound (e.g., Montanide); an ethylene-vinyl acetate copolymer (e.g., Elvax 40W1,2); or lipid A, for example. Such compositions are useful for generating an immune response against a breast cancer directed molecule (e.g., an HLA-binding subsequence within a polypeptide encoded by a nucleotide sequence in SEQ ID NO: 1). In such methods, a peptide having an amino acid subsequence of a polypeptide encoded by a nucleotide sequence in SEQ ID NO: 1-7 is delivered to a subject, where the subsequence binds to an HLA molecule and induces a CTL lymphocyte response. The peptide sometimes is delivered to the subject as an isolated peptide or as a minigene in a plasmid that encodes the peptide. Methods for identifying HLA-binding subsequences in such polypeptides are known (see e.g., publication WO02/20616 and PCT application U.S.98/01373 for methods of identifying such sequences).

[0144] The breast cancer cell may be in a group of breast cancer cells and/or other types of cells cultured in vitro or in a tissue having breast cancer cells (e.g., a melanocytic lesion) maintained in vitro or present in an animal in vivo (e.g., a rat, mouse, ape or human). In certain embodiments, a composition comprises a component from a breast cancer cell or from a subject having a breast cancer cell instead of the breast cancer cell or in addition to the breast cancer cell, where the component sometimes is a nucleic acid molecule (e.g., genomic DNA), a protein mixture or isolated protein, for example. The aforementioned compositions have utility in diagnostic, prognostic and pharmacogenomic methods described previously and in breast cancer therapeutics described hereafter. Certain breast cancer molecules are described in greater detail below.

[0145] Compounds

[0146] Compounds can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; peptoid libraries (libraries of molecules having the functionalities of peptides, but with a novel, non-peptide backbone which are resistant to enzymatic degradation but which nevertheless remain bioactive (see, e.g., Zuckermann et al., J. Med. Chem. 37: 2678-85 (1994)); spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; "one-bead one-compound" library methods; and synthetic library methods using affinity chromatography selection. Biological library and peptoid library approaches are typically limited to peptide libraries, while the other approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, Anticancer Drug Des. 12: 145, (1997)). Examples of methods for synthesizing molecular libraries are described, for example, in DeWitt et al., Proc. Natl. Acad. Sci. U.S.A. 90: 6909 (1993); Erb et al., Proc. Natl. Acad. Sci. USA 91: 11422 (1994); Zuckermann et al., J. Med. Chem. 37: 2678 (1994); Cho et al., Science 261: 1303 (1993); Carrell et al., Angew. Chem. Int. Ed. Engl. 33: 2059 (1994); Carell et al., Angew. Chem. Int. Ed. Engl. 33: 2061 (1994); and in Gallop et al., J. Med. Chem. 37: 1233 (1994).

[0147] Libraries of compounds may be presented in solution (e.g., Houghten, Biotechniques 13: 412-421 (1992)), or on beads (Lam, Nature 354: 82-84 (1991)), chips (Fodor, Nature 364: 555-556 (1993)), bacteria or spores (Ladner, U.S. Pat. No. 5,223,409), plasmids (Cull et al., Proc. Natl. Acad. Sci. USA 89: 1865-1869 (1992)) or on phage (Scott and Smith, Science 249: 386-390 (1990); Devlin, Science 249: 404-406 (1990); Cwirla et al., Proc. Natl. Acad. Sci. 87: 6378-6382 (1990); Felici, J. Mol. Biol. 222: 301-310 (1991); Ladner supra.).

[0148] A compound sometimes alters expression and sometimes alters activity of a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide and may be a small molecule. Small molecules include, but are not limited to, peptides, peptidomimetics (e.g., peptoids), amino acids, amino acid analogs, polynucleotides, polynucleotide analogs, nucleotides, nucleotide analogs, organic or inorganic compounds (i.e., including heteroorganic and organometallic compounds) having a molecular weight less than about 10,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 5,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 1,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 500 grams per mole, and salts, esters, and other pharmaceutically acceptable forms of such compounds.

[0149] Antisense Nucleic Acid Molecules, Ribozymes. RNAi, siRNA and Modified Nucleic Acid Molecules

[0150] An "antisense" nucleic acid refers to a nucleotide sequence complementary to a "sense" nucleic acid encoding a polypeptide, e.g., complementary to the coding strand of a double-stranded cDNA molecule or complementary to an mRNA sequence. The antisense nucleic acid can be complementary to an entire coding strand in SEQ ID NO: 1-17, or to a portion thereof or a substantially identical sequence thereof. In another embodiment, the antisense nucleic acid molecule is antisense to a "noncoding region" of the coding strand of a nucleotide sequence in SEQ ID NO: 1-17 (e.g., 5' and 3' untranslated regions).

[0151] An antisense nucleic acid can be designed such that it is complementary to the entire coding region of an mRNA encoded by a nucleotide sequence in SEQ ID NO: 1-7 (e.g., SEQ ID NO: 8-14), and often the antisense nucleic acid is an oligonucleotide antisense to only a portion of a coding or noncoding region of the mRNA. For example, the antisense oligonucleotide can be complementary to the region surrounding the translation start site of the mRNA, e.g., between the -10 and +10 regions of the target gene nucleotide sequence of interest. An antisense oligonucleotide can be, for example, about 7, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, or more nucleotides in length. The antisense nucleic acids, which include the ribozymes described hereafter, can be designed to target a nucleotide sequence in SEQ ID NO: 1-17, often a variant associated with breast cancer, or a substantially identical sequence thereof. Among the variants, minor alleles and major alleles can be targeted, and those associated with a higher risk of breast cancer are often designed, tested, and administered to subjects.

[0152] An antisense nucleic acid can be constructed using chemical synthesis and enzymatic ligation reactions using standard procedures. For example, an antisense nucleic acid (e.g., an antisense oligonucleotide) can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used. Antisense nucleic acid also can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest, described further in the following subsection).

[0153] When utilized as therapeutics, antisense nucleic acids typically are administered to a subject (e.g., by direct injection at a tissue site) or generated in situ such that they hybridize with or bind to cellular mRNA and/or genomic DNA encoding a polypeptide and thereby inhibit expression of the polypeptide, for example, by inhibiting transcription and/or translation. Alternatively, antisense nucleic acid molecules can be modified to target selected cells and then are administered systemically. For systemic administration, antisense molecules can be modified such that they specifically bind to receptors or antigens expressed on a selected cell surface, for example, by linking antisense nucleic acid molecules to peptides or antibodies which bind to cell surface receptors or antigens. Antisense nucleic acid molecules can also be delivered to cells using the vectors described herein. Sufficient intracellular concentrations of antisense molecules are achieved by incorporating a strong promoter, such as a pol II or pol III promoter, in the vector construct.

[0154] Antisense nucleic acid molecules sometimes are alpha-anomeric nucleic acid molecules. An alpha-anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual beta-units, the strands run parallel to each other (Gaultier et al., Nucleic Acids. Res. 15: 6625-6641 (1987)). Antisense nucleic acid molecules can also comprise a 2'-o-methylribonucleotide (Inoue et al., Nucleic Acids Res. 15: 6131-6148 (1987)) or a chimeric RNA-DNA analogue (Inoue et al., FEBS Lett. 215: 327-330 (1987)). Antisense nucleic acids sometimes are composed of DNA or PNA or any other nucleic acid derivatives described previously.

[0155] In another embodiment, an antisense nucleic acid is a ribozyme. A ribozyme having specificity for a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleotide sequence can include one or more sequences complementary to such a nucleotide sequence, and a sequence having a known catalytic region responsible for mRNA cleavage (see e.g., U.S. Pat. No. 5,093,246 or Haselhoff and Gerlach, Nature 334: 585-591(1988)). For example, a derivative of a Tetrahymena L-19 IVS RNA is sometimes utilized in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in a mRNA (see e.g., Cech et al., U.S. Pat. No. 4,987,071; and Cech et al. U.S. Pat. No. 5,116,742). Also, target mRNA sequences can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules (see e.g., Bartel & Szostak, Science 261: 1411-1418(1993)).

[0156] Breast cancer directed molecules include in certain embodiments nucleic acids that can form triple helix structures with a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleotide sequence or a substantially identical sequence thereof, especially one that includes a regulatory region that controls expression of a polypeptide. Gene expression can be inhibited by targeting nucleotide sequences complementary to the regulatory region of a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleotide sequence or a substantially identical sequence (e.g., promoter and/or enhancers) to form triple helical structures that prevent transcription of a gene in target cells (see e.g., Helene, Anticancer Drug Des. 6(6): 569-84 (1991); Helene et al., Ann. N.Y. Acad. Sci. 660: 27-36 (1992); and Maher, Bioassays 14(12): 807-15 (1992). Potential sequences that can be targeted for triple helix formation can be increased by creating a so-called "switchback" nucleic acid molecule. Switchback molecules are synthesized in an alternating 5'-3',3'-5' manner, such that they base pair with first one strand of a duplex and then the other, eliminating the necessity for a sizeable stretch of either purines or pyrimidines to be present on one strand of a duplex.

[0157] Breast cancer directed molecules include RNAi and siRNA nucleic acids. Gene expression may be inhibited by the introduction of double-stranded RNA (dsRNA), which induces potent and specific gene silencing, a phenomenon called RNA interference or RNAi. See, e.g., Fire et al., U.S. Pat. No. 6,506,559; Tuschl et al. PCT International Publication No. WO 01/75164; Kay et al. PCT International Publication No. WO 03/010180A1; or Bosher J M, Labouesse, Nat Cell Biol 2000 February; 2(2): E31-6. This process has been improved by decreasing the size of the double-stranded RNA to 20-24 base pairs (to create small-interfering RNAs or siRNAs) that "switched off" genes in mammalian cells without initiating an acute phase response, i.e., a host defense mechanism that often results in cell death (see, e.g., Caplen et al. Proc Natl Acad Sci USA. 2001 Aug. 14; 98(17): 9742-7 and Elbashir et al. Methods 2002 February; 26(2): 199-213). There is increasing evidence of post-transcriptional gene silencing by RNA interference (RNAi) for inhibiting targeted expression in mammalian cells at the mRNA level, in human cells. There is additional evidence of effective methods for inhibiting the proliferation and migration of tumor cells in human patients, and for inhibiting metastatic cancer development (see, e.g., U.S. Patent Application No. U.S. 2001000993183; Caplen et al. Proc Natl Acad Sci USA; and Abderrahmani et al. Mol Cell Biol 2001 November 21(21): 7256-67).

[0158] An "siRNA" or "RNAi" refers to a nucleic acid that forms a double stranded RNA and has the ability to reduce or inhibit expression of a gene or target gene when the siRNA is delivered to or expressed in the same cell as the gene or target gene. "siRNA" refers to short double-stranded RNA formed by the complementary strands. Complementary portions of the siRNA that hybridize to form the double stranded molecule often have substantial or complete identity to the target molecule sequence. In one embodiment, an siRNA refers to a nucleic acid that has substantial or complete identity to a target gene and forms a double stranded siRNA.

[0159] When designing the siRNA molecules, the targeted region often is selected from a given DNA sequence beginning 50 to 100 nucleotides downstream of the start codon. See, e.g., Elbashir et al.,. Methods 26: 199-213 (2002). Initially, 5' or 3' UTRs and regions nearby the start codon were avoided assuming that UTR-binding proteins and/or translation initiation complexes may interfere with binding of the siRNP or RISC endonuclease complex. Sometimes regions of the target 23 nucleotides in length conforming to the sequence motif AA(N19)TT (N, an nucleotide), and regions with approximately 30% to 70% G/C-content (often about 50% G/C-content) often are selected. If no suitable sequences are found, the search often is extended using the motif NA(N21). The sequence of the sense siRNA sometimes corresponds to (N 9) TT or N21 (position 3 to 23 of the 23-nt motif), respectively. In the latter case, the 3' end of the sense siRNA often is converted to TT. The rationale for this sequence conversion is to generate a symmetric duplex with respect to the sequence composition of the sense and antisense 3' overhangs. The antisense siRNA is synthesized as the complement to position 1 to 21 of the 23-nt motif. Because position 1 of the 23-nt motif is not recognized sequence-specifically by the antisense siRNA, the 3'-most nucleotide residue of the antisense siRNA can be chosen deliberately. However, the penultimate nucleotide of the antisense siRNA (complementary to position 2 of the 23-nt motif) often is complementary to the targeted sequence. For simplifying chemical synthesis, TT often is utilized. siRNAs corresponding to the target motif NAR(N17)YNN, where R is purine (A,G) and Y is pyrimidine (C,U), often are selected. Respective 21 nucleotide sense and antisense siRNAs often begin with a purine nucleotide and can also be expressed from pol III expression vectors without a change in targeting site. Expression of RNAs from pol III promoters often is efficient when the first transcribed nucleotide is a purine.

[0160] The sequence of the siRNA can correspond to the full length target gene, or a subsequence thereof. Often, the siRNA is about 15 to about 50 nucleotides in length (e.g., each complementary sequence of the double stranded siRNA is 15-50 nucleotides in length, and the double stranded siRNA is about 15-50 base pairs in length, sometimes about 20-30 nucleotides in length or about 20-25 nucleotides in length, e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. The siRNA sometimes is about 21 nucleotides in length. Methods of using siRNA are well known in the art, and specific siRNA molecules may be purchased from a number of companies including Dharmacon Research, Inc.

[0161] Antisense, ribozyme, RNAi and siRNA nucleic acids can be altered to form modified nucleic acid molecules. The nucleic acids can be altered at base moieties, sugar moieties or phosphate backbone moieties to improve stability, hybridization, or solubility of the molecule. For example, the deoxyribose phosphate backbone of nucleic acid molecules can be modified to generate peptide nucleic acids (see Hyrup et al., Bioorganic & Medicinal Chemistry 4 (1): 5-23 (1996)). As used herein, the terms "peptide nucleic acid" or "PNA" refers to a nucleic acid mimic such as a DNA mimic, in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained. The neutral backbone of a PNA can allow for specific hybridization to DNA and RNA under conditions of low ionic strength. Synthesis of PNA oligomers can be performed using standard solid phase peptide synthesis protocols as described, for example, in Hyrup et al., (1996) supra and Perry-O'Keefe et al., Proc. Natl. Acad. Sci. 93: 14670-675 (1996).

[0162] PNA nucleic acids can be used in prognostic, diagnostic, and therapeutic applications. For example, PNAs can be used as antisense or antigene agents for sequence-specific modulation of gene expression by, for example, inducing transcription or translation arrest or inhibiting replication. PNA nucleic acid molecules can also be used in the analysis of single base pair mutations in a gene, (e.g., by PNA-directed PCR clamping); as "artificial restriction enzymes" when used in combination with other enzymes, (e.g., S1 nucleases (Hyrup (1996) supra)); or as probes or primers for DNA sequencing or hybridization (Hyrup et al., (1996) supra; Perry-O'Keefe supra).

[0163] In other embodiments, oligonucleotides may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across cell membranes (see e.g., Letsinger et al., Proc. Natl. Acad. Sci. USA 86: 6553-6556 (1989); Lemaitre et al., Proc. Natl. Acad. Sci. USA 84: 648-652 (1987); PCT Publication No. WO88/09810) or the blood-brain barrier (see, e.g., PCT Publication No. WO89/10134). In addition, oligonucleotides can be modified with hybridization-triggered cleavage agents (See, e.g., Krol et al., Bio-Techniques 6: 958-976 (1988)) or intercalating agents. (See, e.g., Zon, Pharm. Res. 5: 539-549 (1988)). To this end, the oligonucleotide may be conjugated to another molecule, (e.g., a peptide, hybridization triggered cross-linking agent, transport agent, or hybridization-triggered cleavage agent).

[0164] Also included herein are molecular beacon oligonucleotide primer and probe molecules having one or more regions complementary to a nucleotide sequence of SEQ ID NO: 1-17 or a substantially identical sequence thereof, two complementary regions one having a fluorophore and one a quencher such that the molecular beacon is useful for quantifying the presence of the nucleic acid in a sample. Molecular beacon nucleic acids are described, for example, in Lizardi et al., U.S. Pat. No. 5,854,033; Nazarenko et al., U.S. Pat. No. 5,866,336, and Livak et al., U.S. Pat. No. 5,876,930.

[0165] Antibodies

[0166] The term "antibody" as used herein refers to an immunoglobulin molecule or immunologically active portion thereof, i.e., an antigen-binding portion. Examples of immunologically active portions of immunoglobulin molecules include F(ab) and F(ab').sub.2 fragments which can be generated by treating the antibody with an enzyme such as pepsin. An antibody sometimes is a polyclonal, monoclonal, recombinant (e.g, a chimeric or humanized), fully human, non-human (e.g., murine), or a single chain antibody. For example, antibodies that specifically bind to ICAM1 are disclosed in U.S. Pat. Nos. 5,475,091 and 5,773,293. An antibody may have effector function and can fix complement, and is sometimes coupled to a toxin or imaging agent.

[0167] A full-length polypeptide or antigenic peptide fragment encoded by a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleotide sequence can be used as an immunogen or can be used to identify antibodies made with other immunogens, e.g., cells, membrane preparations, and the like. An antigenic peptide often includes at least 8 amino acid residues of the amino acid sequences encoded by a nucleotide sequence of SEQ ID NO: 1-17, or substantially identical sequence thereof, and encompasses an epitope. Antigenic peptides sometimes include 10 or more amino acids, 15 or more amino acids, 20 or more amino acids, or 30 or more amino acids. Hydrophilic and hydrophobic fragments of polypeptides sometimes are used as immunogens.

[0168] Epitopes encompassed by the antigenic peptide are regions located on the surface of the polypeptide (e.g., hydrophilic regions) as well as regions with high antigenicity. For example, an Emini surface probability analysis of the human polypeptide sequence can be used to indicate the regions that have a particularly high probability of being localized to the surface of the polypeptide and are thus likely to constitute surface residues useful for targeting antibody production. The antibody may bind an epitope on any domain or region on polypeptides described herein.

[0169] Also, chimeric, humanized, and completely human antibodies are useful for applications which include repeated administration to subjects. Chimeric and humanized monoclonal antibodies, comprising both human and non-human portions, can be made using standard recombinant DNA techniques. Such chimeric and humanized monoclonal antibodies can be produced by recombinant DNA techniques known in the art, for example using methods described in Robinson et al. International Application No. PCT/US86/02269; Akira, et al. European Patent Application 184,187; Taniguchi, M., European Patent Application 171,496; Morrison et al. European Patent Application 173,494; Neuberger et al. PCT International Publication No. WO 86/01533; Cabilly et al. U.S. Pat. No. 4,816,567; Cabilly et al. European Patent Application 125,023; Better et al., Science 240: 1041-1043 (1988); Liu et al., Proc. Natl. Acad. Sci. USA 84: 3439-3443 (1987); Liu et al., J. Immunol. 139: 3521-3526 (1987); Sun et al., Proc. Natl. Acad. Sci. USA 84: 214-218 (1987); Nishimura et al., Canc. Res. 47: 999-1005 (1987); Wood et al., Nature 314: 446-449 (1985); and Shaw et al., J. Natl. Cancer Inst. 80: 1553-1559 (1988); Morrison, S. L., Science 229: 1202-1207 (1985); Oi et al., BioTechniques 4: 214 (1986); Winter U.S. Pat. No. 5,225,539; Jones et al., Nature 321: 552-525 (1986); Verhoeyan et al., Science 239: 1534; and Beidler et al., J. Immunol. 141: 4053-4060 (1988).

[0170] Completely human antibodies are particularly desirable for therapeutic treatment of human patients. Such antibodies can be produced using transgenic mice that are incapable of expressing endogenous immunoglobulin heavy and light chains genes, but which can express human heavy and light chain genes. See, for example, Lonberg and Huszar, Int. Rev. Immunol. 13: 65-93 (1995); and U.S. Pat. Nos. 5,625,126; 5,633,425; 5,569,825; 5,661,016; and 5,545,806. In addition, companies such as Abgenix, Inc. (Fremont, Calif.) and Medarex, Inc. (Princeton, N.J.), can be engaged to provide human antibodies directed against a selected antigen using technology similar to that described above. Completely human antibodies that recognize a selected epitope also can be generated using a technique referred to as "guided selection." In this approach a selected non-human monoclonal antibody (e.g., a murine antibody) is used to guide the selection of a completely human antibody recognizing the same epitope. This technology is described for example by Jespers et al., Bio/Technology 12: 899-903 (1994).

[0171] Antibody can be a single chain antibody. A single chain antibody (scFV) can be engineered (see, e.g., Colcher et al., Ann. N Y Acad. Sci. 880: 263-80 (1999); and Reiter, Clin. Cancer Res. 2: 245-52 (1996)). Single chain antibodies can be dimerized or multimerized to generate multivalent antibodies having specificities for different epitopes of the same target polypeptide.

[0172] Antibodies also may be selected or modified so that they exhibit reduced or no ability to bind an Fc receptor. For example, an antibody may be an isotype or subtype, fragment or other mutant, which does not support binding to an Fc receptor (e.g., it has a mutagenized or deleted Fc receptor binding region).

[0173] Also, an antibody (or fragment thereof) may be conjugated to a therapeutic moiety such as a cytotoxin, a therapeutic agent or a radioactive metal ion. A cytotoxin or cytotoxic agent includes any agent that is detrimental to cells. Examples include taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1 dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or homologs thereof. Therapeutic agents include, but are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thiotepa chlorambucil, melphalan, carmustine (BCNU) and lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g., vincristine and vinblastine).

[0174] Antibody conjugates can be used for modifying a given biological response. For example, the drug moiety may be a protein or polypeptide possessing a desired biological activity. Such proteins may include, for example, a toxin such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin; a polypeptide such as tumor necrosis factor, ?-interferon, a-interferon, nerve growth factor, platelet derived growth factor, tissue plasminogen activator; or, biological response modifiers such as, for example, lymphokines, interleukin-1 ("IL-1"), interleukin-2 ("IL-2"), interleukin-6 ("1L-6"), granulocyte macrophage colony stimulating factor ("GM-CSF"), granulocyte colony stimulating factor ("G-CSF"), or other growth factors. Also, an antibody can be conjugated to a second antibody to form an antibody heteroconjugate as described by Segal in U.S. Pat. No. 4,676,980, for example.

[0175] An antibody (e.g., monoclonal antibody) can be used to isolate target polypeptides by standard techniques, such as affinity chromatography or immunoprecipitation. Moreover, an antibody can be used to detect a target polypeptide (e.g., in a cellular lysate or cell supernatant) in order to evaluate the abundance and pattern of expression of the polypeptide. Antibodies can be used diagnostically to monitor polypeptide levels in tissue as part of a clinical testing procedure, e.g., to determine the efficacy of a given treatment regimen. Detection can be facilitated by coupling (i.e., physically linking) the antibody to a detectable substance (i.e., antibody labeling). Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, .beta.-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include .sup.125I, .sup.131I, .sup.35S or .sup.3H. Also, an antibody can be utilized as a test molecule for determining whether it can treat breast cancer, and as a therapeutic for administration to a subject for treating breast cancer.

[0176] An antibody can be made by immunizing with a purified antigen, or a fragment thereof, e.g., a fragment described herein, a membrane associated antigen, tissues, e.g., crude tissue preparations, whole cells, preferably living cells, lysed cells, or cell fractions.

[0177] Included herein are antibodies which bind only a native polypeptide, only denatured or otherwise non-native polypeptide, or which bind both, as well as those having linear or conformational epitopes. Conformational epitopes sometimes can be identified by selecting antibodies that bind to native but not denatured polypeptide. Also featured are antibodies that specifically bind to a polypeptide variant associated with breast cancer.

[0178] Screening Assays

[0179] Featured herein are methods for identifying a candidate therapeutic for treating breast cancer. The methods comprise contacting a test molecule with a target molecule in a system. A "target molecule" as used herein refers to a nucleic acid of SEQ ID NO: 1-17, a substantially identical nucleic acid thereof, or a fragment thereof, and an encoded polypeptide of the foregoing. The method also comprises determining the presence or absence of an interaction between the test molecule and the target molecule, where the presence of an interaction between the test molecule and the nucleic acid or polypeptide identifies the test molecule as a candidate breast cancer therapeutic. The interaction between the test molecule and the target molecule may be quantified.

[0180] Test molecules and candidate therapeutics include, but are not limited to, compounds, antisense nucleic acids, siRNA molecules, ribozymes, polypeptides or proteins encoded by a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleic acids, or a substantially identical sequence or fragment thereof, and immunotherapeutics (e.g., antibodies and HLA-presented polypeptide fragments). A test molecule or candidate therapeutic may act as a modulator of target molecule concentration or target molecule function in a system. A "modulator" may agonize (i.e., up-regulates) or antagonize (i.e., down-regulates) a target molecule concentration partially or completely in a system by affecting such cellular functions as DNA replication and/or DNA processing (e.g., DNA methylation or DNA repair), RNA transcription and/or RNA processing (e.g., removal of intronic sequences and/or translocation of spliced mRNA from the nucleus), polypeptide production (e.g., translation of the polypeptide from mRNA), and/or polypeptide post-translational modification (e.g., glycosylation, phosphorylation, and proteolysis of pro-polypeptides). A modulator may also agonize or antagonize a biological function of a target molecule partially or completely, where the function may include adopting a certain structural conformation, interacting with one or more binding partners, ligand binding, catalysis (e.g., phosphorylation, dephosphorylation, hydrolysis, methylation, and isomerization), and an effect upon a cellular event (e.g., effecting progression of breast cancer).

[0181] As used herein, the term "system" refers to a cell free in vitro environment and a cell-based environment such as a collection of cells, a tissue, an organ, or an organism. A system is "contacted" with a test molecule in a variety of manners, including adding molecules in solution and allowing them to interact with one another by diffusion, cell injection, and any administration routes in an animal. As used herein, the term "interaction" refers to an effect of a test molecule on test molecule, where the effect sometimes is binding between the test molecule and the target molecule, and sometimes is an observable change in cells, tissue, or organism.

[0182] There are many standard methods for detecting the presence or absence of an interaction between a test molecule and a target molecule. For example, titrametric, acidimetric, radiometric, NMR, monolayer, polarographic, spectrophotometric, fluorescent, and ESR assays probative of a target molecule interaction may be utilized.

[0183] In general, an interaction can be determined by labeling the test molecule and/or the ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 molecule, where the label is covalently or non-covalently attached to the test molecule or ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 molecule. The label is sometimes a radioactive molecule such as .sup.125I, .sup.131I, .sup.35S or .sup.3H, which can be detected by direct counting of radioemission or by scintillation counting. Also, enzymatic labels such as horseradish peroxidase, alkaline phosphatase, or luciferase may be utilized where the enzymatic label can be detected by determining conversion of an appropriate substrate to product. Also, presence or absence of an interaction can be determined without labeling. For example, a microphysiometer (e.g., Cytosensor) is an analytical instrument that measures the rate at which a cell acidifies its environment using a light-addressable potentiometric sensor (LAPS). Changes in this acidification rate can be used as an indication of an interaction between a test molecule and ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 (McConnell, H. M. et al., Science 257: 1906-1912 (1992)).

[0184] In cell-based systems, cells typically include a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleic acid or polypeptide or variants thereof and are often of mammalian origin, although the cell can be of any origin. Whole cells, cell homogenates, and cell fractions (e.g., cell membrane fractions) can be subjected to analysis. Where interactions between a test molecule with a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide or variant thereof are monitored, soluble and/or membrane bound forms of the polypeptide or variant may be utilized. Where membrane-bound forms of the polypeptide are used, it may be desirable to utilize a solubilizing agent. Examples of such solubilizing agents include non-ionic detergents such as n-octylglucoside, n-dodecylglucoside, n-dodecylmaltoside, octanoyl-N-methylglucamide, decanoyl-N-methylglucamide, Triton.RTM. X-100, Triton.RTM. X-114, Thesit.RTM., Isotridecypoly(ethylene glycol ether).sub.n, 3-[(3-cholamidopropyl)dimethylamminio]-1-propane sulfonate (CHAPS), 3-[(3-cholamidopropyl)dimethylamminio]-2-hydroxy-1-propane sulfonate (CHAPSO), or N-dodecyl-N,N-dimethyl-3-ammonio-1-propane sulfonate.

[0185] An interaction between two molecules also can be detected by monitoring fluorescence energy transfer (FET) (see, for example, Lakowicz et al., U.S. Pat. No. 5,631,169; Stavrianopoulos et al. U.S. Pat. No. 4,868,103). A fluorophore label on a first, "donor" molecule is selected such that its emitted fluorescent energy will be absorbed by a fluorescent label on a second, "acceptor" molecule, which in turn is able to fluoresce due to the absorbed energy. Alternately, the "donor" polypeptide molecule may simply utilize the natural fluorescent energy of tryptophan residues. Labels are chosen that emit different wavelengths of light, such that the "acceptor" molecule label may be differentiated from that of the "donor". Since the efficiency of energy transfer between the labels is related to the distance separating the molecules, the spatial relationship between the molecules can be assessed. In a situation in which binding occurs between the molecules, the fluorescent emission of the "acceptor" molecule label in the assay should be maximal. A FET binding event can be conveniently measured through standard fluorometric detection means well known in the art (e.g., using a fluorimeter).

[0186] In another embodiment, determining the presence or absence of an interaction between a test molecule and a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 molecule can be effected by using real-time Biomolecular Interaction Analysis (BIA) (see, e.g., Sjolander & Urbaniczk, Anal. Chem. 63: 2338-2345 (1991) and Szabo et al., Curr. Opin. Struct. Biol. 5: 699-705 (1995)). "Surface plasmon resonance" or "BIA" detects biospecific interactions in real time, without labeling any of the interactants (e.g., BIAcore). Changes in the mass at the binding surface (indicative of a binding event) result in alterations of the refractive index of light near the surface (the optical phenomenon of surface plasmon resonance (SPR)), resulting in a detectable signal which can be used as an indication of real-time reactions between biological molecules.

[0187] In another embodiment, the ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 molecule or test molecules are anchored to a solid phase. The ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 molecule/test molecule complexes anchored to the solid phase can be detected at the end of the reaction. The target ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 molecule is often anchored to a solid surface, and the test molecule, which is not anchored, can be labeled, either directly or indirectly, with detectable labels discussed herein.

[0188] It may be desirable to immobilize a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 molecule, an anti-ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 antibody, or test molecules to facilitate separation of complexed from uncomplexed forms of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 molecules and test molecules, as well as to accommodate automation of the assay. Binding of a test molecule to a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 molecule can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and micro-centrifuge tubes. In one embodiment, a fusion polypeptide can be provided which adds a domain that allows a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 molecule to be bound to a matrix. For example, glutathione-S-transferase/ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 fusion polypeptides or glutathione-S-transferase/target fusion polypeptides can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivitized microtiter plates, which are then combined with the test compound or the test compound and either the non-adsorbed target polypeptide or ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide, and the mixture incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads or microtiter plate wells are washed to remove any unbound components, the matrix immobilized in the case of beads, complex determined either directly or indirectly, for example, as described above. Alternatively, the complexes can be dissociated from the matrix, and the level of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 binding or activity determined using standard techniques.

[0189] Other techniques for immobilizing a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 molecule on matrices include using biotin and streptavidin. For example, biotinylated ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide or target molecules can be prepared from biotin-NHS(N-hydroxy-succinimide) using techniques known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, Ill.), and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical).

[0190] In order to conduct the assay, the non-immobilized component is added to the coated surface containing the anchored component. After the reaction is complete, unreacted components are removed (e.g., by washing) under conditions such that any complexes formed will remain immobilized on the solid surface. The detection of complexes anchored on the solid surface can be accomplished in a number of ways. Where the previously non-immobilized component is pre-labeled, the detection of label immobilized on the surface indicates that complexes were formed. Where the previously non-immobilized component is not pre-labeled, an indirect label can be used to detect complexes anchored on the surface; e.g., using a labeled antibody specific for the immobilized component (the antibody, in turn, can be directly labeled or indirectly labeled with, e.g., a labeled anti-Ig antibody).

[0191] In one embodiment, this assay is performed utilizing antibodies reactive with ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide or test molecules but which do not interfere with binding of the ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide to its test molecule. Such antibodies can be derivitized to the wells of the plate, and unbound target or ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide trapped in the wells by antibody conjugation. Methods for detecting such complexes, in addition to those described above for the GST-immobilized complexes, include immunodetection of complexes using antibodies reactive with the ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide or target molecule, as well as enzyme-linked assays which rely on detecting an enzymatic activity associated with the ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide or test molecule.

[0192] Alternatively, cell free assays can be conducted in a liquid phase. In such an assay, the reaction products are separated from unreacted components, by any of a number of standard techniques, including but not limited to: differential centrifugation (see, for example, Rivas, G., and Minton, A. P., Trends Biochem Sci August; 18(8): 284-7 (1993)); chromatography (gel filtration chromatography, ion-exchange chromatography); electrophoresis (see, e.g., Ausubel et al., eds. Current Protocols in Molecular Biology, J. Wiley: New York (1999)); and immunoprecipitation (see, for example, Ausubel, F. et al., eds. Current Protocols in Molecular Biology, J. Wiley: New York (1999)). Such resins and chromatographic techniques are known to one skilled in the art (see, e.g., Heegaard, J. Mol. Recognit. Winter; 11(1-6): 141-8 (1998); Hage & Tweed, J. Chromatogr. B Biomed. Sci. Appl. October 10; 699 (1-2): 499-525 (1997)). Further, fluorescence energy transfer may also be conveniently utilized, as described herein, to detect binding without further purification of the complex from solution.

[0193] In another embodiment, modulators of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 expression are identified. For example, a cell or cell free mixture is contacted with a candidate compound and the expression of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 mRNA or polypeptide evaluated relative to the level of expression of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 mRNA or polypeptide in the absence of the candidate compound. When expression of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 mRNA or polypeptide is greater in the presence of the candidate compound than in its absence, the candidate compound is identified as a stimulator of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 mRNA or polypeptide expression. Alternatively, when expression of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 mRNA or polypeptide is less (statistically significantly less) in the presence of the candidate compound than in its absence, the candidate compound is identified as an inhibitor of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 mRNA or polypeptide expression. The level of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 mRNA or polypeptide expression can be determined by methods described herein for detecting ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 mRNA or polypeptide.

[0194] In another embodiment, binding partners that interact with a ICAM, MAPK1, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 molecule are detected. The ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 molecules can interact with one or more cellular or extracellular macromolecules, such as polypeptides, in vivo, and these molecules that interact with ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 molecules are referred to herein as "binding partners." Molecules that disrupt such interactions can be useful in regulating the activity of the target gene product. Such molecules can include, but are not limited to molecules such as antibodies, peptides, and small molecules. Target genes/products for use in this embodiment often are the ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 genes herein identified. In an alternative embodiment, provided is a method for determining the ability of the test compound to modulate the activity of a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide through modulation of the activity of a downstream effector of a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 target molecule. For example, the activity of the effector molecule on an appropriate target can be determined, or the binding of the effector to an appropriate target can be determined, as previously described.

[0195] To identify compounds that interfere with the interaction between the target gene product and its cellular or extracellular binding partner(s), e.g., a substrate, a reaction mixture containing the target gene product and the binding partner is prepared, under conditions and for a time sufficient, to allow the two products to form complex. In order to test an inhibitory agent, the reaction mixture is provided in the presence and absence of the test compound. The test compound can be initially included in the reaction mixture, or can be added at a time subsequent to the addition of the target gene and its cellular or extracellular binding partner. Control reaction mixtures are incubated without the test compound or with a placebo. The formation of any complexes between the target gene product and the cellular or extracellular binding partner is then detected. The formation of a complex in the control reaction, but not in the reaction mixture containing the test compound, indicates that the compound interferes with the interaction of the target gene product and the interactive binding partner. Additionally, complex formation within reaction mixtures containing the test compound and normal target gene product can also be compared to complex formation within reaction mixtures containing the test compound and mutant target gene product. This comparison can be important in those cases where it is desirable to identify compounds that disrupt interactions of mutant but not normal target gene products. Examples of ICAM1 inhibitors are Actimid and Bortezomib, and U.S. Pat. No. 6,436,403 describes a conjugate between ICAM1 and a virus for ICAM1 delivery. Examples of MAPK10 and JUNK modulators are beta arrestin (ARBB2), which is an agonist, CC-401 (Celgene), which is an inhibitor, and other modulators disclosed in WO0246184A1, WO02083667A2, WO02079197A1, WO0112621A1, WO04005283A1, WO0210137A2, WO0112609A1, WO03099221A2, WO02066450A2, WO03102151A2, U.S. 20020160397A1. Examples of MAPK1 screening methods are disclosed in U.S. Pat. No. 6,610,505.

[0196] These assays can be conducted in a heterogeneous or homogeneous format. Heterogeneous assays involve anchoring either the target gene product or the binding partner onto a solid phase, and detecting complexes anchored on the solid phase at the end of the reaction. In homogeneous assays, the entire reaction is carried out in a liquid phase. In either approach, the order of addition of reactants can be varied to obtain different information about the compounds being tested. For example, test compounds that interfere with the interaction between the target gene products and the binding partners, e.g., by competition, can be identified by conducting the reaction in the presence of the test substance. Alternatively, test compounds that disrupt preformed complexes, e.g., compounds with higher binding constants that displace one of the components from the complex, can be tested by adding the test compound to the reaction mixture after complexes have been formed. The various formats are briefly described below.

[0197] In a heterogeneous assay system, either the target gene product or the interactive cellular or extracellular binding partner, is anchored onto a solid surface (e.g., a microtiter plate), while the non-anchored species is labeled, either directly or indirectly. The anchored species can be immobilized by non-covalent or covalent attachments. Alternatively, an immobilized antibody specific for the species to be anchored can be used to anchor the species to the solid surface.

[0198] In order to conduct the assay, the partner of the immobilized species is exposed to the coated surface with or without the test compound. After the reaction is complete, unreacted components are removed (e.g., by washing) and any complexes formed will remain immobilized on the solid surface. Where the non-immobilized species is pre-labeled, the detection of label immobilized on the surface indicates that complexes were formed. Where the non-immobilized species is not pre-labeled, an indirect label can be used to detect complexes anchored on the surface; e.g., using a labeled antibody specific for the initially non-immobilized species (the antibody, in turn, can be directly labeled or indirectly labeled with, e.g., a labeled anti-Ig antibody). Depending upon the order of addition of reaction components, test compounds that inhibit complex formation or that disrupt preformed complexes can be detected.

[0199] Alternatively, the reaction can be conducted in a liquid phase in the presence or absence of the test compound, the reaction products separated from unreacted components, and complexes detected; e.g., using an immobilized antibody specific for one of the binding components to anchor any complexes formed in solution, and a labeled antibody specific for the other partner to detect anchored complexes. Again, depending upon the order of addition of reactants to the liquid phase, test compounds that inhibit complex or that disrupt preformed complexes can be identified.

[0200] In an alternate embodiment, a homogeneous assay can be used. For example, a preformed complex of the target gene product and the interactive cellular or extracellular binding partner product is prepared in that either the target gene products or their binding partners are labeled, but the signal generated by the label is quenched due to complex formation (see, e.g., U.S. Pat. No. 4,109,496 that utilizes this approach for immunoassays). The addition of a test substance that competes with and displaces one of the species from the preformed complex will result in the generation of a signal above background. In this way, test substances that disrupt target gene product-binding partner interaction can be identified.

[0201] Also, binding partners of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 molecules can be identified in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Pat. No. 5,283,317; Zervos et al., Cell 72: 223-232 (1993); Madura et al., J. Biol. Chem. 268: 12046-12054 (1993); Bartel et al., Biotechniques 14: 920-924 (1993); Iwabuchi et al., Oncogene 8: 1693-1696 (1993); and Brent WO94/10300), to identify other polypeptides, which bind to or interact with ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 ("ICAM, MAPK10, KIAA0861, NUAM1, GALE, DPF3 or LOC145197-binding polypeptides" or "ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197-bp") and are involved in ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 activity. Such ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197-bps can be activators or inhibitors of signals by the ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptides or ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 targets as, for example, downstream elements of a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197-mediated signaling pathway.

[0202] A two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains. Briefly, the assay utilizes two different DNA constructs. In one construct, the gene that codes for a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide is fused to a gene encoding the DNA binding domain of a known transcription factor (e.g., GAL-4). In the other construct, a DNA sequence, from a library of DNA sequences, that encodes an unidentified polypeptide ("prey" or "sample") is fused to a gene that codes for the activation domain of the known transcription factor. (Alternatively the: ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide can be the fused to the activator domain.) If the "bait" and the "prey" polypeptides are able to interact, in vivo, forming a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197-dependent complex, the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ) which is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected and cell colonies containing the functional transcription factor can be isolated and used to obtain the cloned gene which encodes the polypeptide which interacts with the ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide.

[0203] Candidate therapeutics for treating breast cancer are identified from a group of test molecules that interact with a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleic acid or polypeptide. Test molecules are normally ranked according to the degree with which they interact or modulate (e.g., agonize or antagonize) DNA replication and/or processing, RNA transcription and/or processing, polypeptide production and/or processing, and/or function of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 molecules, for example, and then top ranking modulators are selected. In a preferred embodiment, the candidate therapeutic (i.e., test molecule) acts as a ICAM, MAPK10, KIAA0861, NUAM1, GALE, DPF3 or LOC145197 antagonist. Also, pharmacogenomic information described herein can determine the rank of a modulator. Candidate therapeutics typically are formulated for administration to a subject.

[0204] Therapeutic Treatments

[0205] Formulations or pharmaceutical compositions typically include in combination with a pharmaceutically acceptable carrier, a compound, an antisense nucleic acid, a ribozyme, an antibody, a binding partner that interacts with a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide, a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleic acid, or a fragment thereof. The formulated molecule may be one that is identified by a screening method described above. As used herein, the term "pharmaceutically acceptable carrier" includes solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Supplementary active compounds can also be incorporated into the compositions.

[0206] A pharmaceutical composition is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerin, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

[0207] Oral compositions generally include an inert diluent or an edible carrier. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules, e.g., gelatin capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.

[0208] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor E.TM. (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride sometimes are included in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[0209] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation often utilized are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

[0210] For administration by inhalation, the compounds are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.

[0211] Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art. Molecules can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.

[0212] In one embodiment, active molecules are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. Materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.

[0213] It is advantageous to formulate oral or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.

[0214] Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD.sub.50 (the dose lethal to 50% of the population) and the ED.sub.50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD.sub.50/ED.sub.50. Molecules which exhibit high therapeutic indices often are utilized. While molecules that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.

[0215] The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such molecules often lies within a range of circulating concentrations that include the ED.sub.50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any molecules used in the methods described herein, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC.sub.50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.

[0216] As defined herein, a therapeutically effective amount of protein or polypeptide (i.e., an effective dosage) ranges from about 0.001 to 30 mg/kg body weight, sometimes about 0.01 to 25 mg/kg body weight, often about 0.1 to 20 mg/kg body weight, and more often about 1 to 10 mg/kg, 2 to 9 mg/kg, 3 to 8 mg/kg, 4 to 7 mg/kg, or 5 to 6 mg/kg body weight. The protein or polypeptide can be administered one time per week for between about 1 to 10 weeks, sometimes between 2 to 8 weeks, often between about 3 to 7 weeks, and more often for about 4, 5, or 6 weeks. The skilled artisan will appreciate that certain factors may influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of a protein, polypeptide, or antibody can include a single treatment, or sometimes can include a series of treatments.

[0217] With regard to polypeptide formulations, featured herein is a method for treating breast cancer in a subject, which comprises contacting one or more cells in the subject with a first ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide, where the subject comprises a second ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide having one or more polymorphic variations associated with cancer, and where the first polypeptide comprises fewer polymorphic variations associated with cancer than the second polypeptide. The first and second polypeptides are encoded by a nucleic acid which comprises a nucleotide sequence selected from the group consisting of the nucleotide sequence of SEQ ID NO: 1-17; a nucleotide sequence which encodes a polypeptide consisting of an amino acid sequence encoded by a nucleotide sequence of SEQ ID NO: 1-17; a nucleotide sequence which encodes a polypeptide that is 90% or more identical to an amino acid sequence encoded by a nucleotide sequence of SEQ ID NO: 1-17 and a nucleotide sequence 90% or more identical to a nucleotide sequence of SEQ ID NO: 1-17. The subject is often a human.

[0218] For antibodies, a dosage of 0.1 mg/kg of body weight (generally 10 mg/kg to 20 mg/kg) is often utilized. If the antibody is to act in the brain, a dosage of 50 mg/kg to 100 mg/kg is often appropriate. Generally, partially human antibodies and fully human antibodies have a longer half-life within the human body than other antibodies. Accordingly, lower dosages and less frequent administration is often possible. Modifications such as lipidation can be used to stabilize antibodies and to enhance uptake and tissue penetration (e.g., into the brain). A method for lipidation of antibodies is described by Cruikshank et al., J. Acquired Immune Deficiency Syndromes and Human Retrovirology 14: 193 (1997).

[0219] Antibody conjugates can be used for modifying a given biological response, the drug moiety is not to be construed as limited to classical chemical therapeutic agents. For example, the drug moiety may be a protein or polypeptide possessing a desired biological activity. Such proteins may include, for example, a toxin such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin; a polypeptide such as tumor necrosis factor, .alpha.-interferon, .beta.-interferon, nerve growth factor, platelet derived growth factor, tissue plasminogen activator; or, biological response modifiers such as, for example, lymphokines, interleukin-1 ("IL-1"), interleukin-2 ("IL-2"), interleukin-6 ("IL-6"), granulocyte macrophage colony stimulating factor ("GM-CSF"), granulocyte colony stimulating factor ("G-CSF"), or other growth factors. Alternatively, an antibody can be conjugated to a second antibody to form an antibody heteroconjugate as described by Segal in U.S. Pat. No. 4,676,980.

[0220] For compounds, exemplary doses include milligram or microgram amounts of the compound per kilogram of subject or sample weight, for example, about 1 microgram per kilogram to about 500 milligrams per kilogram, about 100 micrograms per kilogram to about 5 milligrams per kilogram, or about 1 microgram per kilogram to about 50 micrograms per kilogram. It is understood that appropriate doses of a small molecule depend upon the potency of the small molecule with respect to the expression or activity to be modulated. When one or more of these small molecules is to be administered to an animal (e.g., a human) in order to modulate expression or activity of a polypeptide or nucleic acid described herein, a physician, veterinarian, or researcher may, for example, prescribe a relatively low dose at first, subsequently increasing the dose until an appropriate response is obtained. In addition, it is understood that the specific dose level for any particular animal subject will depend upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, gender, and diet of the subject, the time of administration, the route of administration, the rate of excretion, any drug combination, and the degree of expression or activity to be modulated.

[0221] ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleic acid molecules can be inserted into vectors and used in gene therapy methods for treating breast cancer. Featured herein is a method for treating breast cancer in a subject, which comprises contacting one or more cells in the subject with a first ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleic acid, where genomic DNA in the subject comprises a second ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleic acid comprising one or more polymorphic variations associated with breast cancer, and where the first nucleic acid comprises fewer polymorphic variations associated with breast cancer. The first and second nucleic acids typically comprise a nucleotide sequence selected from the group consisting of the nucleotide sequence of SEQ ID NO: 1-7; a nucleotide sequence which encodes a polypeptide consisting of an amino acid sequence encoded by a nucleotide sequence in SEQ ID NO: 1-7; a nucleotide sequence that is 90% or more identical to the nucleotide sequence of SEQ ID NO: 1-7, and a nucleotide sequence which encodes a polypeptide that is 90% or more identical to an amino acid sequence encoded by a nucleotide sequence in SEQ ID NO: 1-7. The subject often is a human.

[0222] Gene therapy vectors can be delivered to a subject by, for example, intravenous injection, local administration (see U.S. Pat. No. 5,328,470) or by stereotactic injection (see e.g., Chen et al., (1994) Proc. Natl. Acad. Sci. USA 91: 3054-3057). Pharmaceutical preparations of gene therapy vectors can include a gene therapy vector in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded. Alternatively, where the complete gene delivery vector can be produced intact from recombinant cells (e.g., retroviral vectors) the pharmaceutical preparation can include one or more cells which produce the gene delivery system. Examples of gene delivery vectors are described herein.

[0223] Pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration.

[0224] Pharmaceutical compositions of active ingredients can be administered by any of the paths described herein for therapeutic and prophylactic methods for treating breast cancer. With regard to both prophylactic and therapeutic methods of treatment, such treatments may be specifically tailored or modified, based on knowledge obtained from pharmacogenomic analyses described herein. As used herein, the term "treatment" is defined as the application or administration of a therapeutic agent to a patient, or application or administration of a therapeutic agent to an isolated tissue or cell line from a patient, who has a disease, a symptom of disease or a predisposition toward a disease, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve or affect the disease, the symptoms of disease or the predisposition toward disease. A therapeutic agent includes, but is not limited to, small molecules, peptides, antibodies, ribozymes and antisense oligonucleotides.

[0225] Administration of a prophylactic agent can occur prior to the manifestation of symptoms characteristic of the ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 aberrance, such that a disease or disorder is prevented or, alternatively, delayed in its progression. Depending on the type of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 aberrance, for example, a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 molecule, ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 agonist, or ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 antagonist agent can be used for treating the subject. The appropriate agent can be determined based on screening assays described herein.

[0226] As discussed, successful treatment of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 disorders can be brought about by techniques that serve to inhibit the expression or activity of target gene products. For example, compounds (e.g., an agent identified using an assays described above) that exhibit negative modulatory activity can be used to prevent and/or treat breast cancer. Such molecules can include, but are not limited to peptides, phosphopeptides, small organic or inorganic molecules, or antibodies (including, for example, polyclonal, monoclonal, humanized, anti-idiotypic, chimeric or single chain antibodies, and FAb, F(ab')2 and FAb expression library fragments, scFV molecules, and epitope-binding fragments thereof).

[0227] Further, antisense and ribozyme molecules that inhibit expression of the target gene can also be used to reduce the level of target gene expression, thus effectively reducing the level of target gene activity. Still further, triple helix molecules can be utilized in reducing the level of target gene activity. Antisense, ribozyme and triple helix molecules are discussed above.

[0228] It is possible that the use of antisense, ribozyme, and/or triple helix molecules to reduce or inhibit mutant gene expression can also reduce or inhibit the transcription (triple helix) and/or translation (antisense, ribozyme) of mRNA produced by normal target gene alleles, such that the concentration of normal target gene product present can be lower than is necessary for a normal phenotype. In such cases, nucleic acid molecules that encode and express target gene polypeptides exhibiting normal target gene activity can be introduced into cells via gene therapy method. Alternatively, in instances where the target gene encodes an extracellular polypeptide, normal target gene polypeptide often is co-administered into the cell or tissue to maintain the requisite level of cellular or tissue target gene activity.

[0229] Another method by which nucleic acid molecules may be utilized in treating or preventing a disease characterized by ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 expression is through the use of aptamer molecules specific for ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide. Aptamers are nucleic acid molecules having a tertiary structure which permits them to specifically bind to polypeptide ligands (see, e.g., Osborne, et al., Curr. Opin. Chem. Biol. 1(1): 5-9 (1997); and Patel, D. J., Curr. Opin. Chem. Biol. June; 1(1): 32-46 (1997)). Since nucleic acid molecules may in many cases be more conveniently introduced into target cells than therapeutic polypeptide molecules may be, aptamers offer a method by which ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide activity may be specifically decreased without the introduction of drugs or other molecules which may have pluripotent effects.

[0230] Antibodies can be generated that are both specific for target gene product and that reduce target gene product activity. Such antibodies may, therefore, by administered in instances whereby negative modulatory techniques are appropriate for the treatment of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 disorders. For a description of antibodies, see the Antibody section above.

[0231] In circumstances where injection of an animal or a human subject with a ICAM, MAPK10, KIAA0861, NUMA1; GALE, DPF3 or LOC145197 polypeptide or epitope for stimulating antibody production is harmful to the subject, it is possible to generate an immune response against ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 through the use of anti-idiotypic antibodies (see, for example, Herlyn, D., Ann. Med.; 31(1): 66-78 (1999); and Bhattacharya-Chatterjee & Foon, Cancer Treat. Res.; 94: 51-68 (1998)). If an anti-idiotypic antibody is introduced into a mammal or human subject, it should stimulate the production of anti-anti-idiotypic antibodies, which should be specific to the ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide. Vaccines directed to a disease characterized by ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 expression may also be generated in this fashion.

[0232] In instances where the target antigen is intracellular and whole antibodies are used, internalizing antibodies may be utilized. Lipofectin or liposomes can be used to deliver the antibody or a fragment of the Fab region that binds to the target antigen into cells. Where fragments of the antibody are used, the smallest inhibitory fragment that binds to the target antigen often is utilized. For example, peptides having an amino acid sequence corresponding to the Fv region of the antibody can be used. Alternatively, single chain neutralizing antibodies that bind to intracellular target antigens can also be administered. Such single chain antibodies can be administered, for example, by expressing nucleotide sequences encoding single-chain antibodies within the target cell population (see e.g., Marasco et al., Proc. Natl. Acad. Sci. USA 90: 7889-7893 (1993)).

[0233] ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 molecules and compounds that inhibit target gene expression, synthesis and/or activity can be administered to a patient at therapeutically effective doses to prevent, treat or ameliorate ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 disorders. A therapeutically effective dose refers to that amount of the compound sufficient to result in amelioration of symptoms of the disorders.

[0234] Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD.sub.50 (the dose lethal to 50% of the population) and the ED.sub.50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD.sub.50/ED.sub.50. Compounds that exhibit large therapeutic indices often are utilized. While compounds that exhibit toxic side effects can be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.

[0235] Data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds often lies within a range of circulating concentrations that include the ED.sub.50 with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in a method described herein, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC.sub.50 (i.e., the concentration of the test compound that achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma can be measured, for example, by high performance liquid chromatography.

[0236] Another example of effective dose determination for an individual is the ability to directly assay levels of "free" and "bound" compound in the serum of the test subject. Such assays may utilize antibody mimics and/or "biosensors" that have been created through molecular imprinting techniques.

[0237] The compound which is able to modulate ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 activity is used as a template, or "imprinting molecule", to spatially organize polymerizable monomers prior to their polymerization with catalytic reagents. The subsequent removal of the imprinted molecule leaves a polymer matrix which contains a repeated "negative image" of the compound and is able to selectively rebind the molecule under biological assay conditions. A detailed review of this technique can be seen in Ansell et al., Current Opinion in Biotechnology 7: 89-94 (1996) and in Shea, Trends in Polymer Science 2: 166-173 (1994). Such "imprinted" affinity matrixes are amenable to ligand-binding assays, whereby the immobilized monoclonal antibody component is replaced by an appropriately imprinted matrix. An example of the use of such matrixes in this way can be seen in Vlatakis, et al., Nature 361: 645-647 (1993). Through the use of isotope-labeling, the "free" concentration of compound which modulates the expression or activity of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 can be readily monitored and used in calculations of IC.sub.50. Such "imprinted" affinity matrixes can also be designed to include fluorescent groups whose photon-emitting properties measurably change upon local and selective binding of target compound. These changes can be readily assayed in real time using appropriate fiberoptic devices, in turn allowing the dose in a test subject to be quickly optimized based on its individual IC.sub.50. A rudimentary example of such a "biosensor" is discussed in Kriz et al., Analytical Chemistry 67: 2142-2144 (1995).

[0238] Provided herein are methods of modulating ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 expression or activity for therapeutic purposes. Accordingly, in an exemplary embodiment, the modulatory method involves contacting a cell with a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 or agent that modulates one or more of the activities of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide activity associated with the cell. An agent that modulates ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide activity can be an agent as described herein, such as a nucleic acid or a polypeptide, a naturally-occurring target molecule of a ICAM, MAPK10, KIAA0861, NUMA41, GALE, DPF3 or LOC145197 polypeptide (e.g., a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 substrate or receptor), a ICAM, MAPK10, KIAA0861, NUMA41, GALE, DPF3 or LOC145197 antibody, a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 agonist or antagonist, a peptidomimetic of a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 agonist or antagonist, or other small molecule.

[0239] In one embodiment, the agent stimulates one or more ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 activities. Examples of such stimulatory agents include active ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide and a nucleic acid molecule encoding ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197. In another embodiment, the agent inhibits one or more ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 activities. Examples of such inhibitory agents include antisense ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 nucleic acid molecules, anti-ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 antibodies, and ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 inhibitors, and competitive inhibitors that target ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197. These modulatory methods can be performed in vitro (e.g., by culturing the cell with the agent) or, alternatively, in vivo (e.g., by administering the agent to a subject). As such, provided are methods of treating an individual afflicted with a disease or disorder characterized by aberrant or unwanted expression or activity of a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide or nucleic acid molecule. In one embodiment, the method involves administering an agent (e.g., an agent identified by a screening assay described herein), or combination of agents that modulates (e.g., upregulates or downregulates) ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 expression or activity. In another embodiment, the method involves administering a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polypeptide or nucleic acid molecule as therapy to compensate for reduced, aberrant, or unwanted ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 expression or activity.

[0240] Stimulation of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 activity is desirable in situations in which ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 is abnormally downregulated and/or in which increased ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 activity is likely to have a beneficial effect. For example, stimulation of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 activity is desirable in situations in which a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 is downregulated and/or in which increased ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 activity is likely to have a beneficial effect. Likewise, inhibition of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 activity is desirable in situations in which ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 is abnormally upregulated and/or in which decreased ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 activity is likely to have a beneficial effect.

[0241] Methods of Treatment

[0242] In another aspect, provided are methods for identifying a risk of cancer in an individual as described herein and, if a genetic predisposition is identified, treating that individual to delay or reduce or prevent the development of cancer. Such a procedure can be used to treat breast cancer. Optionally, treating an individual for cancer may include inhibiting cellular proliferation, inhibiting metastasis, inhibiting invasion, or preventing tumor formation or growth as defined herein. Suitable treatments to prevent or reduce or delay breast cancer focus on inhibiting additional cellular proliferation, inhibiting metastasis, inhibiting invasion, and preventing further tumor formation or growth. Treatment usually includes surgery followed by radiation therapy. Surgery may be a lumpectomy or a mastectomy (e.g., total, simple or radical). Even if the doctor removes all of the cancer that can be seen at the time of surgery, the patient may be given radiation therapy, chemotherapy, or hormone therapy after surgery to try to kill any cancer cells that may be left. Radiation therapy is the use of x-rays or other types of radiation to kill cancer cells and shrink tumors. Radiation therapy may use external radiation (using a machine outside the body) or internal radiation. Chemotherapy is the use of drugs to kill cancer cells. Chemotherapy may be taken by mouth, or it may be put into the body by inserting a needle into a vein or muscle. Hormone therapy often focuses on estrogen and progesterone, which are hormones that affect the way some cancers grow. If tests show that the cancer cells have estrogen and progesterone receptors (molecules found in some cancer cells to which estrogen and progesterone will attach), hormone therapy is used to block the way these hormones help the cancer grow. Hormone therapy with tamoxifen is often given to patients with early stages of breast cancer and those with metastatic breast cancer. Other types of treatment being tested in clinical trials include sentinel lymph node biopsy followed by surgery and high-dose chemotherapy with bone marrow transplantation and peripheral blood stem cell transplantation. Any preventative/therapeutic treatment known in the art may be prescribed and/or administered, including, for example, surgery, chemotherapy and/or radiation treatment, and any of the treatments may be used in combination with one another to treat or prevent breast cancer (e.g., surgery followed by radiation therapy).

[0243] Also provided are methods of preventing or treating cancer comprising providing an individual in need of such treatment with a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 inhibitor that reduces or inhibits the overexpression of mutant ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 (e.g., a ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 polynucleotide with an allele that is associated with cancer). Included herein are methods of reducing or blocking the expression of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 comprising providing or administering to individuals in need of reducing or blocking the expression of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 a pharmaceutical or physiologically acceptable composition comprising a molecule capable of inhibiting expression of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197, e.g., a siRNA molecule. Also included herein are methods of reducing or blocking the expression of secondary regulatory genes regulated by ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 that play a role in oncogenesis which comprises introducing competitive inhibitors that target the effect of ICAM, MAPK10, KIAA0861, NUMA1, GALE, DPF3 or LOC145197 on these regulatory genes or that block the binding of positive factors necessary for the expression of these regulatory genes.

[0244] The examples set forth below are intended to illustrate but not limit the invention.

EXAMPLES

[0245] In the following studies a group of subjects were selected according to specific parameters relating to breast cancer. Nucleic acid samples obtained from individuals in the study group were subjected to genetic analysis, which identified associations between breast cancer and certain polymorphic variants in ICAM region, MAPK10, KIAA0861, NUMA1/FLJ20625/LOC220074 region, and HT014/LOC148902/LYPLA2/GALE region loci (herein referred to as "target genes", "target nucleotides", "target polypeptides" or simply "targets"). In addition, methods are described for combining information from multiple SNPs from the target genes found to be independently associated with breast cancer status in a case-control study. The resulting model permits a powerful, more informative quantitation of the combined value of the SNPs for predicting breast cancer susceptibility.

Example 1

Samples and Pooling Strategies

[0246] Sample Selection

[0247] Blood samples were collected from individuals diagnosed with breast cancer, which were referred to as case samples. Also, blood samples were collected from individuals not diagnosed with breast cancer as gender and age-matched controls. All of the samples were of German/German descent. A database was created that listed all phenotypic trait information gathered from individuals for each case and control sample. Genomic DNA was extracted from each of the blood samples for genetic analyses.

[0248] DNA Extraction from Blood Samples

[0249] Six to ten milliliters of whole blood was transferred to a 50 ml tube containing 27 ml of red cell lysis solution (RCL). The tube was inverted until the contents were mixed. Each tube was incubated for 10 minutes at room temperature and inverted once during the incubation. The tubes were then centrifuged for 20 minutes at 3000.times.g and the supernatant was carefully poured off. 100-200 .mu.l of residual liquid was left in the tube and was pipetted repeatedly to resuspend the pellet in the residual supernatant. White cell lysis solution (WCL) was added to the tube and pipetted repeatedly until completely mixed. While no incubation was normally required, the solution was incubated at 37.degree. C. or room temperature if cell clumps were visible after mixing until the solution was homogeneous. 2 ml of protein precipitation was added to the cell lysate. The mixtures were vortexed vigorously at high speed for 20 sec to mix the protein precipitation solution uniformly with the cell lysate, and then centrifuged for 10 minutes at 3000.times.g. The supernatant containing the DNA was then poured into a clean 15 ml tube, which contained 7 ml of 100% isopropanol. The samples were mixed by inverting the tubes gently until white threads of DNA were visible. Samples were centrifuged for 3 minutes at 2000.times.g and the DNA was visible as a small white pellet. The supernatant was decanted and 5 ml of 70% ethanol was added to each tube. Each tube was inverted several times to wash the DNA pellet, and then centrifuged for 1 minute at 2000.times.g. The ethanol was decanted and each tube was drained on clean absorbent paper. The DNA was dried in the tube by inversion for 10 minutes, and then 1000 .mu.l of 1.times.TE was added. The size of each sample was estimated, and less TE buffer was added during the following DNA hydration step if the sample was smaller. The DNA was allowed to rehydrate overnight at room temperature, and DNA samples were stored at 2-8.degree. C.

[0250] DNA was quantified by placing samples on a hematology mixer for at least 1 hour. DNA was serially diluted (typically 1: 80, 1: 160, 1: 320, and 1: 640 dilutions) so that it would be within the measurable range of standards. 125 .mu.l of diluted DNA was transferred to a clear U-bottom microtitre plate, and 125 .mu.l of 1.times.TE buffer was transferred into each well using a multichannel pipette. The DNA and 1.times.TE were mixed by repeated pipetting at least 15 times, and then the plates were sealed. 50 .mu.l of diluted DNA was added to wells A5-H12 of a black flat bottom microtitre plate. Standards were inverted six times to mix them, and then 50 .mu.l of 1.times.TE buffer was pipetted into well A1, 1000 ng/ml of standard was pipetted into well A2, 500 ng/ml of standard was pipetted into well A3, and 250 ng/ml of standard was pipetted into well A4. PicoGreen (Molecular Probes, Eugene, Oreg.) was thawed and freshly diluted 1: 200 according to the number of plates that were being measured. PicoGreen was vortexed and then 50 .mu.l was pipetted into all wells of the black plate with the diluted DNA. DNA and PicoGreen were mixed by pipetting repeatedly at least 10 times with the multichannel pipette. The plate was placed into a Fluoroskan Ascent Machine (microplate fluorometer produced by Labsystems) and the samples were allowed to incubate for 3 minutes before the machine was run using filter pairs485 nm excitation and 538 nm emission wavelengths. Samples having measured DNA concentrations of greater than 450 ng/.mu.l were re-measured for conformation. Samples having measured DNA concentrations of 20 ng/.mu.l or less were re-measured for confirmation.

[0251] Pooling Strategies

[0252] Samples were placed into one of two groups based on disease status. The two groups were female case groups and female control groups. A select set of samples from each group were utilized to generate pools, and one pool was created for each group. Each individual sample in a pool was represented by an equal amount of genomic DNA. For example, where 25 ng of genomic DNA was utilized in each PCR reaction and there were 200 individuals in each pool, each individual would provide 125 pg of genomic DNA. Inclusion or exclusion of samples for a pool was based upon the following criteria: the sample was derived from an individual characterized as Caucasian; the sample was derived from an individual of German paternal and maternal descent; the database included relevant phenotype information for the individual; case samples were derived from individuals diagnosed with breast cancer; control samples were derived from individuals free of cancer and no family history of breast cancer; and sufficient genomic DNA was extracted from each blood sample for all allelotyping and genotyping reactions performed during the study. Phenotype information included pre- or post-menopausal, familial predisposition, country or origin of mother and father, diagnosis with breast cancer (date of primary diagnosis, age of individual as of primary diagnosis, grade or stage of development, occurrence of metastases, e.g., lymph node metastases, organ metastases), condition of body tissue (skin tissue, breast tissue, ovary tissue, peritoneum tissue and myometrium), method of treatment (surgery, chemotherapy, hormone therapy, radiation therapy). Samples that met these criteria were added to appropriate pools based on gender and disease status.

[0253] The selection process yielded the pools set forth in Table 1, which were used in the studies that follow:

3 TABLE 1 Female CASE Female CONTROL Pool size 272 276 (Number) Pool Criteria case control (ex: case/control) Mean Age 59.6 55.4 (ex: years)

Example 2

Association of Polymorphic Variants with Breast cancer

[0254] A whole-genome screen was performed to identify particular SNPs associated with occurrence of breast cancer. As described in Example 1, two sets of samples were utilized, which included samples from female individuals having breast cancer (breast cancer cases) and samples from female individuals not having cancer (female controls). The initial screen of each pool was performed in an allelotyping study, in which certain samples in each group were pooled. By pooling DNA from each group, an allele frequency for each SNP in each group was calculated. These allele frequencies were then compared to one another. Particular SNPs were considered as being associated with breast cancer when allele frequency differences calculated between case and control pools were statistically significant. SNP disease association results obtained from the allelotyping study were then validated by genotyping each associated SNP across all samples from each pool. The results of the genotyping were then analyzed, allele frequencies for each group were calculated from the individual genotyping results, and a p-value was calculated to determine whether the case and control groups had statistically significantly differences in allele frequencies for a particular SNP. When the genotyping results agreed with the original allelotyping results, the SNP disease association was considered validated at the genetic level.

[0255] SNP Panel Used for Genetic Analyses

[0256] A whole-genome SNP screen began with an initial screen of approximately 25,000 SNPs over each set of disease and control samples using a pooling approach. The pools studied in the screen are described in Example 1. The SNPs analyzed in this study were part of a set of 25,488 SNPs confirmed as being statistically polymorphic as each is characterized as having a minor allele frequency of greater than 10%. The SNPs in the set reside in genes or in close proximity to genes, and many reside in gene exons. Specifically, SNPs in the set are located in exons, introns, and within 5,000 base-pairs upstream of a transcription start site of a gene. In addition, SNPs were selected according to the following criteria: they are located in ESTs; they are located in Locuslink or Ensemble genes; and they are located in Genomatix promoter predictions. SNPs in the set also were selected on the basis of even spacing across the genome, as depicted in Table 2.

[0257] A case-control study design using a whole genome association strategy involving approximately 28,000 single nucleotide polymorphisms (SNPs) was employed. Approximately 25,000 SNPs were evenly spaced in gene-based regions of the human genome with a median inter-marker distance of about 40,000 base pairs. Additionally, approximately 3,000 SNPs causing amino acid substitutions in genes described in the literature as candidates for various diseases were used. The case-control study samples were of female German origin (German paternal and maternal descent) 548 individuals were equally distributed in two groups (female controls and female cases). The whole genome association approach was first conducted on 2 DNA pools representing the 2 groups. Significant markers were confirmed by individual genotyping.

4TABLE 2 General Statistics Spacing Statistics Total # of SNPs 28,532 Median 34,424 bp # of Exonic SNPs 8,497 (30%) Minimum* 1,000 bp # SNPs with 26,625 (93%) Maximum* 3,000,000 bp refSNP ID Gene Coverage 23,874 Mean 122,412 bp Chromosome All Std Deviation 354, bp Coverage *Excludes outliers

[0258] Allelotyping and Genotyping Results

[0259] The genetic studies summarized above and described in more detail below identified allelic variants associated with breast cancer. The allelic variants identified from the SNP panel described in Table 2 are summarized below in Table 3.

5TABLE 3 Chromo- Position SNP Chromo- some in SEQ ID Contig Contig Sequence Sequence Allelic Reference some Position NO: 1-7 Identification Position Identification Locus Position Variability 11549918 19 10263938 44247 NT_011295 1665740 NM_003259 ICAM region Exon C/T (I301V) 1541998 4 87408539 36424 NT_016354 11444849 NM_002753 MAPK10 intron C/T 2001449 3 184049849 48563 NT_005612 89424094 NM_015078 KIAA0861 intron G/C NM_006185 NUMA1 upstream T/C 673478 11 71525412 49002 NT_033927 1998133 NM_017907 FLJ20625 downstream NM_145309 LOC220074 intron NM_000403 GALE downstream A/G 4237 1 23583604 87877 NT_004610 4917379 NM_020362 HT014 3'utr NM_007260 LYPLA2 upstream 1990440 14 71267195 40095 NT_026437 53197195 NM_012074 DPF3 intron G/C 1054745 14 99900494 NT_026437 81830494 XM_096734 LOC145197 upstream G/A

[0260] Table 3 includes information pertaining to the incident polymorphic variant associated with breast cancer identified herein. Public information pertaining to the polymorphism and the genomic sequence that includes the polymorphism are indicated. The genomic sequences identified in Table 3 may be accessed at the http address www.ncbi.nih.gov/entrez/qu- ery.fcgi, for example, by using the publicly available SNP reference number (e.g., rs1541998). The chromosome position refers to the position of the SNP within NCBI's Genome Build 34, which may be accessed at the following http address: www.ncbi.nlm.nih.gov/mapview/map_search.cgi?chr=h- um_chr.inf&query=. The "Contig Position" provided in Table 3 corresponds to a nucleotide position set forth in the contig sequence, and designates the polymorphic site corresponding to the SNP reference number. The sequence containing the polymorphisms also may be referenced by the "Sequence Identification" set forth in Table 3. The "Sequence Identification" corresponds to cDNA sequence that encodes associated target polypeptides (e.g., NUMA1) of the invention. The position of the SNP within the cDNA sequence is provided in the "Sequence Position" column of Table 3. Also, the allelic variation at the polymorphic site and the allelic variant identified as associated with breast cancer is specified in Table 3. All nucleotide sequences referenced and accessed by the parameters set forth in Table 3 are incorporated herein by reference. The positions for these SNPs are indicated in the tables below and in SEQ ID NO: 1-7.

[0261] Assay for Verifying, Allelotyping, and Genotyping SNPs

[0262] A MassARRAY.TM. system (Sequenom, Inc.) was utilized to perform SNP genotyping in a high-throughput fashion. This genotyping platform was complemented by a homogeneous, single-tube assay method (hME.TM. or homogeneous MassEXTEND.TM. (Sequenom, Inc.)) in which two genotyping primers anneal to and amplify a genomic target surrounding a polymorphic site of interest. A third primer (the MassEXTEND.TM. primer), which is complementary to the amplified target up to but not including the polymorphism, was then enzymatically extended one or a few bases through the polymorphic site and then terminated.

[0263] For each polymorphism, SpectroDESIGNER.TM. software (Sequenom, Inc.) was used to generate a set of PCR primers and a MassEXTEND.TM. primer was used to genotype the polymorphism. Table 4 shows PCR primers and Table 5 shows extension primers used for analyzing polymorphisms. The initial PCR amplification reaction was performed in a 5 .mu.l total volume containing 1.times.PCR buffer with 1.5 mM MgCl.sub.2 (Qiagen), 200 .mu.M each of dATP, dGTP, dCTP, dTTP (Gibco-BRL), 2.5 ng of genomic DNA, 0.1 units of HotStar DNA polymerase (Qiagen), and 200 nM each of forward and reverse PCR primers specific for the polymorphic region of interest.

6TABLE 4 PCR Primers Refer- ence Forward Reverse SNP ID PCR primer PCR primer 11549918 GACAGCCACAGCTAGCGCAGA TGTTTTCGCCCCCCAGG GTGAC 1541998 CTGATTATTCTGATGGTAATG GCCCATGTTAACATTTTCTTC 2001449 ATGTCAAGTGCACCCACATG AGGAAGAAACTGACGGAAGG 673478 TAATACAAAGGTGGCAGCAG TTGACAAGGATAAGGACAAG 4237 GCACATGGCCACATTAACTGG TGGCTGTGGAAATTGGG TCTTG 1990440 CCAGGGTGTGTTCTAATACG AAGTCACTAACCCCACACAC 1054745 GACTTTTAGGTCTGAGTTGG CTTCCTCTAGCAGTGTATTTC

[0264] Samples were incubated at 95.degree. C. for 15 minutes, followed by 45 cycles of 95.degree. C. for 20 seconds, 56.degree. C. for 30 seconds, and 72.degree. C. for 1 minute, finishing with a 3 minute final extension at 72.degree. C. Following amplification, shrimp alkaline phosphatase (SAP) (0.3 units in a 2 .mu.l volume) (Amersham Pharmacia) was added to each reaction (total reaction volume was 7 .mu.l) to remove any residual dNTPs that were not consumed in the PCR step. Samples were incubated for 20 minutes at 37.degree. C., followed by 5 minutes at 85.degree. C. to denature SAP.

[0265] Once the SAP reaction was complete, a primer extension reaction was initiated by adding a polymorphism-specific MassEXTEND.TM. primer cocktail to each sample. Each MassEXTEND.TM. cocktail included a specific combination of dideoxynucleotides (ddNTPs) and deoxynucleotides (dNTPs) used to distinguish polymorphic alleles from one another. In Table 5, ddNTPs are shown and the fourth nucleotide not shown is the dNTP.

7TABLE 5 Extend Primers Reference Extend Term SNP ID Probe Mix 11549918 CCCAGGGTGACGTTGCAGA ACG 1541998 ATTATTCTGATGGTAATGATCCAG ACG 2001449 CACATGCCTGCTCGCCCCC ACT 673478 AAGGGGAGGTCGACTGGG ACT 4237 GGCATCTGGCAGTCATGG ACT 1990440 CGTCAGCAAATGTGTACCGA ACT 10547457 TTGGTCCATTAGGGAATTAGA ACG

[0266] The Mass EXTEND.TM. reaction was performed in a total volume of 9 .mu.l, with the addition of 1.times. ThermoSequenase buffer, 0.576 units of ThermoSequenase (Arnersham Pharmacia), 600 nM MassEXTEND.TM. primer, 2 mM of ddATP and/or ddCTP and/or ddGTP and/or ddTTP, and 2 mM of dATP or dCTP or dGTP or dTTP. The deoxy nucleotide (dNTP) used in the assay normally was complementary to the nucleotide at the polymorphic site in the amplicon. Samples were incubated at 94.degree. C. for 2 minutes, followed by 55 cycles of 5 seconds at 94.degree. C., 5 seconds at 52.degree. C., and 5 seconds at 72.degree. C.

[0267] Following incubation, samples were desalted by adding 16 .mu.l of water (total reaction volume was 25 .mu.l), 3 mg of SpectroCLEAN.TM. sample cleaning beads (Sequenom, Inc.) and allowed to incubate for 3 minutes with rotation. Samples were then robotically dispensed using a piezoelectric dispensing device (SpectroJET.TM. (Sequenom, Inc.)) onto either 96-spot or 384-spot silicon chips containing a matrix that crystallized each sample (SpectroCHIP.RTM. (Sequenom, Inc.)). Subsequently, MALDI-TOF mass spectrometry (Biflex and Autoflex MALDI-TOF mass spectrometers (Bruker Daltonics) can be used) and SpectroTYPER RT.TM. software (Sequenom, Inc.) were used to analyze and interpret the SNP genotype for each sample.

[0268] Genetic Analysis

[0269] Variations identified in the target genes are provided in their respective genomic sequences (see FIGS. 1-7) Minor allelic frequencies for these polymorphisms was verified as being 10% or greater by determining the allelic frequencies using the extension assay described above in a group of samples isolated from 92 individuals originating from the state of Utah in the United States, Venezuela and France (Coriell cell repositories).

[0270] Genotyping results are shown for female pools in Table 6A and 6B. Table 6A shows the orginal genotyping results and Table 6B shows the genotyped results re-analyzed to remove duplicate individuals from the cases and controls (i.e., individuals who were erroneously included more than once as either cases or controls). Therefore, Table 6B represents a more accurate measure of the allele frequencies for this particular SNP. In the subsequent tables, "AF" refers to allelic frequency; and "F case" and "F control" refer to female case and female control groups, respectively.

8TABLE 6A Breast Cancer Reference AF F AF F Assoc. SNP ID case control p-value Odds Ratio Allele 11549918 C = 0.651 C = 0.564 0.0038 0.69 C T = 0.349 T = 0.436 1541998 T = 0.780 T = 0.839 0.0153 0.69 C C = 0.220 C = 0.161 2001449 G = 0.703 G = 0.780 0.0040 1.49 C C = 0.297 C = 0.220 673478 T = 0.919 T = 0.953 0.0238 1.74 C C = 0.081 C = 0.047 4237 A = 0.590 A = 0.530 0.0431 0.78 A G = 0.410 G = 0.470 1990440 C = 0.876 C = 0.926 0.0027 0.65 G G = 0.124 G = 0.074 1054745 A = 0.871 A = 0.805 0.0039 A G = 0.129 G = 0.195

[0271]

9TABLE 6B Breast Cancer Reference AF F AF F Assoc. SNP ID case control p-value Odds Ratio Allele 11549918 C = 0.658 C = 0.556 0.0012 0.65 C T = 0.342 T = 0.444 1541998 T = 0.771 T = 0.839 0.0070 0.65 C C = 0.229 C = 0.161 2001449 G = 0.693 G = 0.782 0.0012 1.59 C C = 0.307 C = 0.218 673478 T = 0.916 T = 0.953 0.0171 1.85 C C = 0.084 C = 0.047 4237 A = 0.584 A = 0.527 0.0704 0.79 A G = 0.416 G = 0.473 1990440 C = 0.879 C = 0.915 0.0692 0.67 G G = 0.121 G = 0.085 1054745 A = 0.866 A = 0.801 0.0061 1.60 A G = 0.134 G = 0.199

[0272] The single marker alleles set forth in Table 3 were considered validated, since the genotyping data for the females, males or both pools were significantly associated with breast cancer, and because the genotyping results agreed with the original allelotyping results. Particularly significant associations with breast cancer are indicated by a calculated p-value of less than 0.05 for genotype results, which are set forth in bold text.

[0273] Odds ratio results are shown in Tables 6A and 6B. An odds ratio is an unbiased estimate of relative risk which can be obtained from most case-control studies. Relative risk (RR) is an estimate of the likelihood of disease in the exposed group (susceptibility allele or genotype carriers) compared to the unexposed group (not carriers). It can be calculated by the following equation:

RR=IA/Ia

[0274] IA is the incidence of disease in the A carriers and Ia is the incidence of disease in the non-carriers.

[0275] RR>1 indicates the A allele increases disease susceptibility.

[0276] RR.ltoreq.1 indicates the a allele increases disease susceptibility.

[0277] For example, RR=1.5 indicates that carriers of the A allele have 1.5 times the risk of disease than 50% more likely to get the disease.

[0278] Case-control studies do not allow the direct estimation of IA and Ia, therefore relative risk cannot be directly estimated. However, the odds ratio (OR) can be calculated using the following equation:

OR=(nDAnda)/(ndAnDa)=pDA(1-pdA)/pdA(131 pDA), or

[0279] OR=((case f)/(1-case f))/((control f)/(1-control f)), where f=susceptibility allele frequency.

[0280] An odds ratio can be interpreted in the same way a relative risk is interpreted and can be directly estimated using the data from case-control studies, i.e., case and control allele frequencies. The higher the odds ratio value, the larger the effect that particular allele has on the development of breast cancer. Possessing an allele associated with a relatively high odds ratio translates to having a higher risk of developing or having breast cancer.

Example 3

Samples and Pooling Strategies for the Replication Samples

[0281] The SNPs of Table 3 were genotyped again in a collection of replication samples to further validate its association with breast cancer. Like the original study population described in Examples 1 and 2, the replication samples consisted of females diagnosed with breast cancer (cases) and females without cancer (controls). The case and control samples were selected and genotyped as described below.

[0282] Pooling Strategies

[0283] Samples were placed into one of two groups based on disease status. The two groups were female case groups and female control groups. A select set of samples from each group were utilized to generate pools, and one pool was created for each group. Each individual sample in a pool was represented by an equal amount of genomic DNA. For example, where 25 ng of genomic DNA was utilized in each PCR reaction and there were 190 individuals in each pool (i.e., 190 cases and 190 controls), each individual would provide 125 pg of genomic DNA. Inclusion or exclusion of samples for a pool was based upon the following criteria: the sample was derived from a female individual characterized as Caucasian from Australia; case samples were derived from individuals diagnosed with breast cancer; control samples were derived from individuals free of cancer and no family history of breast cancer; and sufficient genomic DNA was extracted from each blood sample for all allelotyping and genotyping reactions performed during the study. Samples in the pools also were age-matched. Samples that met these criteria were added to appropriate pools based on gender and disease status.

[0284] The selection process yielded the "Griffith" samples set forth in Table 7A and the "Kiechle" samples set forth in Table 7B, which were used in the studies that follow:

10 TABLE 7A Female CASE Female CONTROL Pool size 190 190 (Number) Pool Criteria case control (ex: case/control) Mean Age 64.5 ** (ex: years) ** Each case was matched by a control within 5 years of age of the case.

[0285]

11 TABLE 7B Female CASE Female CONTROL Pool size 195 153 (Number) Pool Criteria case control (ex: case/control)

[0286] The replication genotyping results are shown in Table 8A for the Griffith samples and in Table 8B for the Kiechle samples. The odds ratio was calculated as described in Example 2.

12TABLE 8A Reference AF AF SNP ID F case F control p-value Odds Ratio 11549918 C = 0.650 C = 0.584 0.0624 0.75 T = 0.350 T = 0.416 1541998 T = 0.820 T = 0.864 0.1010 0.72 C = 0.180 C = 0.136 2001449 G = 0.685 G = 0.777 0.005 1.59 C = 0.315 C = 0.223 673478 T = 0.927 T = 0.957 0.077 1.76 C = 0.073 C = 0.043 4237 A = 0.632 A = 0.577 0.1260 1.26 G = 0.368 G = 0.423 1990440 C = 0.822 C = 0.860 0.172 0.756 G = 0.178 G = 0.140 1054745 A = 0.894 A = 0.921 0.224 0.726 G = 0.106 G = 0.079

[0287]

13TABLE 8B Reference AF AF SNP ID F case F control p-value Odds Ratio 11549918 C = 0.641 C = 0.570 0.066 0.74 T = 0.359 T = 0.430 1541998 T = 0.811 T = 0.791 0.521 1.14 C = 0.189 C = 0.209 2001449 G = 0.754 G = 0.716 0.267 0.82 C = 0.246 C = 0.284 673478 T = 0.942 T = 0.955 0.474 1.30 C = 0.058 C = 0.045 4237 A = 0.618 A = 0.587 0.429 0.88 G = 0.382 G = 0.413 1990440 C = 0.889 C = 0.924 0.124 0.66 G = 0.111 G = 0.076 1054745 A = 0.877 A = 0.819 0.0396 1.57 G = 0.123 G = 0.181

[0288] The absence of a statistically significant association in the replication cohort should not be interpreted as minimizing the value of the original finding. There are many reasons why a biologically derived association identified in a sample from one population would not replicate in a sample from another population. The most important reason is differences in population history. Due to bottlenecks and founder effects, there may be common disease predisposing alleles present in one population that are relatively rare in another, leading to a lack of association in the candidate region. Also, because common diseases such as breast cancer are the result of susceptibilities in many genes and many environmental risk factors, differences in population-specific genetic and environmental backgrounds could mask the effects of a biologically relevant allele. For these and other reasons, statistically strong results in the original, discovery sample that did not replicate in the replication sample may be further evaluated in additional replication cohorts and experimental systems.

Example 4

ICAM Region Proximal SNPs

[0289] It has been discovered that a polymorphic variation (rs11549918) in a region that encodes ICAM1, ICAM2 and ICAM5 is associated with the occurrence of breast cancer (see Examples 1 and 2). Subsequently, SNPs proximal to the incident SNP (rs1549918) were identified and allelotyped in breast cancer sample sets and control sample sets as described in Examples 1 and 2. Approximately 195 allelic variants located within the ICAM region were identified and allelotyped. The polymorphic variants are set forth in Table 9. The chromosome position provided in column four of Table 9 is based on Genome "Build 34" of NCBI's GenBank.

14TABLE 9 Position in Chromosome Allele Genome Deduced dbSNP rs# SEQ ID NO: 1 Chromosome Position Variants Letter Iupac 2884487 230 19 10219830 t/c c Y 2358580 4282 19 10223882 a/g g R 2304236 11844 19 10231444 a/c a M 1059840 11890 19 10231490 a/t t W 1059843 11905 19 10231505 c/t c Y 11115 11942 19 10231542 t/c c Y 1059849 12054 19 10231654 g/a a R 1059855 12070 19 10231670 t/c c Y 5030386 21497 19 10241097 c/g c S 5030339 21537 19 10241137 a/g g R 5030387 21682 19 10241282 t/g t K 5030388 22073 19 10241673 a/g g R 1799766 22393 19 10241993 c/-- c N 5030389 22394 19 10241994 a/-- a N 5490 23227 19 10242827 c/a a M 11575070 23614 19 10243214 c/g g S 5030340 23681 19 10243281 c/t c Y 5030390 23937 19 10243537 a/g g R 5030391 24037 19 10243637 a/g g R 3093035 24373 19 10243973 a/g g R 11667983 24589 19 10244189 c/t c Y 5030341 24675-24676 19 10244275{circumflex over ( )} ct/-- ct NN 10244276 5030342 24680 19 10244280 t/g g K 5030343 24754 19 10244354 t/c c Y 5030344 25053 19 10244653 g/a g R 5030347 26004 19 10245604 a/c c M 5030348 26023 19 10245623 a/g a R 5030349 26046 19 10245646 t/c c Y 5030350 26100 19 10245700 a/t a W 5030351 26817 19 10246417 t/c c Y 5491 26940 19 10246540 t/a a W 5030352 27143 19 10246743 g/c c S 5030353 27162 19 10246762 a/g g R 10420063 28328 19 10247928 g/a a R 11879117 28799 19 10248399 g/c g S 5030354 29166 19 10248766 a/c a M 5030355 29331 19 10248931 a/c a M 281428 29724 19 10249324 c/t c Y 5030358 29773 19 10249373 g/a a R 5030359 29862 19 10249462 a/g g R 5030392 29877 19 10249477 t/c c Y 5030393 30194 19 10249794 t/g g K 5030360 30258 19 10249858 t/g g K 5030394 30549 19 10250149 a/g g R 281429 30648 19 10250248 t/c c Y 5030361 30909 19 10250509 t/c c Y 5030362 30962 19 10250562 a/c c M 281430 31337 19 10250937 g/a a R 281431 31345 19 10250945 t/c t Y 5030395 31534 19 10251134 c/t c Y 5827095 31942 19 10251542 a/-- a N 281432 32058 19 10251658 g/c c S 5030364 32109 19 10251709 a/t t W 5030365 32401 19 10252001 a/g a R 5030368 32845 19 10252445 g/a a R 5030369 32864 19 10252464 t/c c Y 3073809 32965-32966 19 10252565{circumflex over ( )} tt/-- tt NN 10252566 2358581 33011 19 10252611 g/t t K 7258215 33170 19 10252770 c/t t Y 5030371 33516 19 10253116 a/g g R 5030372 33608 19 10253208 t/c t Y 281433 33623 19 10253223 a/c a M 5030374 33672 19 10253272 c/a a M 5030375 33724 19 10253324 a/-- a N 5030397 33787 19 10253387 t/g g K 281434 34020 19 10253620 g/a a R 12462944 34038 19 10253638 c/g g S 5030398 34190 19 10253790 c/g c S 5030378 34706 19 10254306 c/g c S 12459133 34778 19 10254378 t/g g K 5030399 35553 19 10255153 a/g g R 5492 35690 19 10255290 g/c g S 1800019 36173 19 10255773 a/c c M 1799969 36192 19 10255792 g/a g R 5493 36194 19 10255794 t/g g K 5030381 36308 19 10255908 c/t c Y 5494 36317 19 10255917 c/t c Y 3093033 36431 19 10256031 g/a g R 5495 36496 19 10256096 g/a g R 1801714 36608 19 10256208 c/t c Y 2071441 36708 19 10256308 c/t c Y 5496 36847 19 10256447 a/g g R 5497 36868 19 10256468 a/g g R 5030382 37083 19 10256683 g/a a R 5030400 37196 19 10256796 c/t c Y 2071440 37373 19 10256973 g/a g R 5499 37465 19 10257065 c/t c Y 3093032 37736 19 10257336 t/c c Y 1057981 37959 19 10257559 g/a a R 5500 38031 19 10257631 a/g a R 5501 38091 19 10257691 t/c t Y 5030383 38243 19 10257843 t/c c Y 281436 38531 19 10258131 a/g g R 923366 38623 19 10258223 t/c c Y 281437 38638 19 10258238 c/t c Y 3093030 38803 19 10258403 t/c c Y 5030384 39489 19 10259089 a/g g R 5030385 40008 19 10259608 g/c c S 3810159 40711 19 10260311 t/c g R 281438 40775 19 10260375 t/g t K 3093029 40951 19 10260551 c/g c S 2735442 41218 19 10260818 g/c g S 2569693 41304 19 10260904 c/t c Y 281439 41510 19 10261110 g/c g S 281440 41704 19 10261304 g/a g R 2569694 42020 19 10261620 c/t c Y 11575073 42210 19 10261810 c/t c Y 2569695 42302 19 10261902 c/g c S 2075741 42498 19 10262098 g/c g S 11575074 42520 19 10262120 a/g g R 2569696 42607 19 10262207 a/g g R 2735439 42674 19 10262274 t/g t K 2569697 42929 19 10262529 g/c g S 2075742 43007 19 10262607 g/c g S 2569698 43040 19 10262640 c/g c S 11669397 43246 19 10262846 c/t c Y 901886 43531 19 10263131 t/c t Y 885742 44023 19 10263623 g/a a R 2569699 44024 19 10263624 t/g t K 11549918 44338 19 10263938 c/t g R 2569700 44499 19 10264099 t/g g K 2228615 44768 19 10264368 a/g g R ICAM-AA 45003 19 10264603 c/t c Y 2569701 45341 19 10264941 g/a g R 2569702 45347 19 10264947 t/c t Y 2735440 45577 19 10265177 g/a a R 2569703 45627 19 10265227 c/g c S 10418913 45794 19 10265394 a/g g R 1056536 46244 19 10265844 c/t g R 2569704 46469 19 10266069 t/c c Y 11673661 46999 19 10266599 g/c g S 10402760 47265 19 10266865 t/c c Y 0 47504 19 10267104 a/g g R 2569706 47547 19 10267147 g/a g R 2569707 47637 19 10267237 c/g g S 2436545 47691 19 10267291 c/a a M 2436546 47692 19 10267292 a/c a M 2916060 47788 19 10267388 a/c t K 2916059 47796 19 10267396 t/c a R 2916058 47800 19 10267400 t/a a W 2569708 47812 19 10267412 a/g g R 735747 47969 19 10267569 t/c t Y 885743 48035 19 10267635 a/t t W 710845 48569 19 10268169 c/g g S 2569709 48823 19 10268423 c/g c S 2569710 48838 19 10268438 a/g a R 2569711 48894 19 10268494 c/g c S 2569712 48934 19 10268534 a/t a W 12610026 49249 19 10268849 a/g g R 4804129 49509 19 10269109 c/a a M 12150978 49718 19 10269318 a/g a R 439843 49963 19 10269563 c/a c M 892188 51193 19 10270793 t/c c Y 2291473 57181 19 10276781 t/c t Y 281416 60184 19 10279784 a/g a R 281417 60530 19 10280130 t/c c Y 882589 61354 19 10280954 t/c g R 1048941 62616 19 10282216 t/g c M 281418 62785 19 10282385 g/c g S 430092 66351 19 10285951 c/t t Y 368835 67386 19 10286986 a/g a R 2358583 67395 19 10286995 t/g g K 378395 67822 19 10287422 c/a a M 395782 68028 19 10287628 t/c t Y 1045384 68646 19 10288246 t/g g K 281427 70520 19 10290120 c/t t Y 3745264 70966 19 10290566 t/g c M 281426 72451 19 10292051 g/a g R 281425 73199 19 10292799 g/t g K 281424 74319 19 10293919 c/t t Y 281423 76893 19 10296493 c/t t Y 281422 77755 19 10297355 t/c t Y 281420 79354 19 10298954 a/g a R 3745263 80901 19 10300501 a/g c Y 3745262 80940 19 10300540 t/c a R 3745261 81111 19 10300711 t/c a R 3181049 82517 19 10302117 t/c g R

281412 82874 19 10302474 t/c t Y 3181048 84978 19 10304578 a/g t Y 2230399 86003 19 10305603 c/g c S 2278442 86226 19 10305826 g/a g R 3181047 87206 19 10306806 a/g c Y 3181046 87535 19 10307135 t/c a R 2304237 87968 19 10307568 t/c t Y 281413 88134 19 10307734 g/a g R 1058154 88297 19 10307897 a/c c M 3176769 88434 19 10308034 t/c a R 2304238 90602 19 10310202 g/a a R 2304239 90750 19 10310350 t/c c Y 2304240 90792 19 10310392 g/a a R 3176768 91065 19 10310665 a/g c Y 3176767 91151 19 10310751 c/a t K 3176766 91178 19 10310778 c/t g R 281414 91685 19 10311285 g/a g R 281415 92393 19 10311993 t/g g K

[0290] Assay for Verifying and Allelotyping SNPs

[0291] The methods used to verify and allelotype the proximal SNPs of Table 9 are the same methods described in Examples 1 and 2 herein. The PCR primers and extend primers used in these assays are provided in Table 10 and Table 11, respectively.

15TABLE 10 dbSNP rs# Forward PCR primer Reverse PCR primer 2884487 ACGTTGGATGTGTGGCAAATGATGGAACAG ACGTTGGATGCCAGAAGTTTGAGATCTGCC 2358580 ACGTTGGATGTCGCGTGCGTGACGTCATCC ACGTTGGATGCGGGAGGTCAAGGCCACTG 2304236 ACGTTGGATGTCACATCAACAGTGGTACGG ACGTTGGATGAGCCTGCCCTACAGCGACTT 1059840 ACGTTGGATGTCGGCCTGGCTCAGAAGAGG ACGTTGGATGACCCCTACCCCACGCTACCCA 1059843 ACGTTGGATGCCACCCCGTACCACTGTTGA ACGTTGGATGTGAGGCTCCCAAGTCGGCCA 11115 ACGTTGGATGAGGTGACACCTTCCTCGAAG ACGTTGGATGTGTGAAGCACCTCTTCTGAG 1059849 ACGTTGGATGGGAATGGATGCAGAAGCCCG ACGTTGGATGAAGCTGAGGCCACAGGGAG 1059855 ACGTTGGATGAAAAACAAAAAGAGGGAATG ACGTTGGATGGGCCATCGCCATTGGGAAG 5030386 ACGTTGGATGTTGAACTCCTGGGCTCAAGT ACGTTGGATGAGACAAAAATCCACCTGGGC 5030339 ACGTTGGATGTCAAGTGATCCTCCCATCTC ACGTTGGATGGGACACAGGAATGAACAGAG 5030387 ACGTTGGATGAAGAACGGCACCATTGTGGC ACGTTGGATGTTCCACTGAGCTCTTGCCCC 5030388 ACGTTGGATGTCGGAGATCTCCATGGCGA ACGTTGGATGACCACGTCGAGGCTGGGTAC 1799766 ACGTTGGATGGTTTCCCCGCGGAGCCTGG ACGTTGGATGTCCCTACGCGCCGAGCCCC 5030389 ACGTTGGATGAAAAGGAAGGAAGCTGCGTG ACGTTGGATGAAGCTAGCTGCCTCAGTTTC 5490 ACGTTGGATGCCTCTGCTACTCAGAGTTGC ACGTTGGATGACTCACCTGGGAACAGAGC 11575070 ACGTTGGATGTAGCCTTACCTCCTGCCTCA ACGTTGGATGACGCAATCTAGCCAAGCAAG 5030340 ACGTTGGATGATGAGAGGTGTGAACCACCG ACGTTGGATGTGGCCGCTATAACGTTTCCC 5030390 ACGTTGGATGTTATCCGTGGCCCAAAGCTG ACGTTGGATGAAAGACCCTCTGACCCCTTC 5030391 ACGTTGGATGTGTAAGTTTGGGGAACCAGG ACGTTGGATGCTGGATCTCAGGCTTTGTTG 3093035 ACGTTGGATGGGAGACATAGCGAGATTCTG ACGTTGGATGTAGAAAGCAGTGCGATCTGG 11667983 ACGTTGGATGATCTTTGAGTGAGGCAGTGC ACGTTGGATGAGGGGCTTATTTGGATCAG- G 5030341 ACGTTGGATGGAATCTGAGGGACCTGATCC ACGTTGGATGTTGCAGTGAGCCGAGATCAC 5030342 ACGTTGGATGTTTTTGAGACGGAGTCTCAC ACGTTGGATGAGGAGAATCGTTTGAACCTG 5030343 ACGTTGGATGTGTAGTCCCAGCTACTCAGG ACGTTGGATGTGATCTCGGCTCACTGCAAC 5030344 ACGTTGGATGAAGAAGTCAGGTGGAGACAG ACGTTGGATGAAATTGAGGCCCAAAGAGGG 5030347 ACGTTGGATGAATCTCAGCTCACTGCAACC ACGTTGGATGGCCTGTAATCCCAGATACTC 5030348 ACGTTGGATGGGAGAATCACTTGAACCCGG ACGTTGGATGAGTCTCGCTTTGTCACTCAG 5030349 ACGTTGGATGTCTCGCTTTGTCACTCAGAC ACGTTGGATGAATCACTTGAACCCGGGAGG 5030350 ACGTTGGATGCACTGAAGGCCATGCTAAAG ACGTTGGATGACTCCAGTCTGAGTGACAAA 5030351 ACGTTGGATGTGCCAGGTCCTAGAAGAAAC ACGTTGGATGCGCACATTCCCTTGATGAAC 5491 ACGTTGGATGTGACATGCAGCACCTCCTGT ACGTTGGATGGGAGCAACTCCTTTTTAGGC 5030352 ACGTTGGATGTACGAGCAAGTGGCAAAGATT ACGTTGGATGTGAGTAACTGAGCCCGGAGG 5030353 ACGTTGGATGTACTGTGAGTAACTGAGCCC ACGTTGGATGAGCAAGTGGCAAAGATTCC- C 10420063 ACGTTGGATGATCTCCTGACCTTGTGATCC ACGTTGGATGGCCCTGGGATGGCATTTTTC 11879117 ACGTTGGATGTGGTCAGGCTGGTCTCGAACT ACGTTGGATGAAATGTCATGGGCTGGGCAC 5030354 ACGTTGGATGCTCTCTTCTCATAGCCAGCT ACGTTGGATGATTAGGGAAGGGCAGTTTC- G 5030355 ACGTTGGATGGGCCGGAGAATCACTTAAAC ACGTTGGATGAGAGTTTCACTCTTGTTGCC 281428 ACGTTGGATGAGTAGCTGGAATTACAGGCG ACGTTGGATGGCCAACATGATGAAATCCCG 5030358 ACGTTGGATGCACAAGGTCAGGAGATCAAG ACGTTGGATGCCACGCCTGGCTAATTTTTG 5030359 ACGTTGGATGCCAAAGTGCTGGGATTACAG ACGTTGGATGAAGTCCCCAAAGTAGGAAGG 5030392 ACGTTGGATGTTCGAAGTCCCCAAAGTAGG ACGTTGGATGAAAGTGCTGGGATTACAGGC 5030393 ACGTTGGATGTAGTCCCAGCTACTCAGGAG ACGTTGGATGTGTCATCACGGCTCACTACA 5030360 ACGTTGGATGTGTAGTGAGCCGTGATGACA ACGTTGGATGTCCCAAAGCTACTTGGCCAG 5030394 ACGTTGGATGTGAGCAGATGCTGACCTTCC ACGTTGGATGAAGACCTTCAAAGAGGTTTC 281429 ACGTTGGATGCGACAGAGCAAGACTGTGTG ACGTTGGATGCTTTTCTGCATCTCTGCCTG 5030361 ACGTTGGATGTATGCTCTCAGCTATCAGGC ACGTTGGATGACTCTAGACCTCTGGTGATC 5030362 ACGTTGGATGCCACAGTCATAGAGGGAGAA ACGTTGGATGCCTGATAGCTGAGAGCATAG 281430 ACGTTGGATGATTACAGGTGTGAGCCACTG ACGTTGGATGGCAGGGAGAAATCTTGATGG 281431 ACGTTGGATGACTGGGATTACAGGTGTGAG ACGTTGGATGGGAGAAATCTTGATGGAGGC 5030395 ACGTTGGATGAACTACTCTGGAGGCTCAAG ACGTTGGATGCAGAGTGAGACTCCATCTCA 5827095 ACGTTGGATGCCCTTCCTCCCATCAATCAA ACGTTGGATGATTGCACCACTGCATTCCAG 281432 ACGTTGGATGTCAGCTATCTAATCCCTGGC ACGTTGGATGAGCTGGGACTTTCCTTCTTG 5030364 ACGTTGGATGTTCTTGAATACGGTCACTGC ACGTTGGATGCTGAAGGCTGGATTTACTGG 5030365 ACGTTGGATGAGCTGGAGGTCAGAGTTTTC ACGTTGGATGCCTGAGACCCTGTCTCTAAA 5030368 ACGTTGGATGTCATCTGAGGTTGGGAGTTC ACGTTGGATGCGACACCACACAAGGCTAAT 5030369 ACGTTGGATGAGGTGGATCATCTGAGGTTG ACGTTGGATGGACAGGGTTTCTCCATGTTG 3073809 ACGTTGGATGACCGTGCCCGGCCTTTTTTT ACGTTGGATGATCGAACCACTGCACTCCTG 2358581 ACGTTGGATGTAAGGCAGGAGGATGGAGTG ACGTTGGATGGACAGAGTCTCACTCTGTCG 7258215 ACGTTGGATGGTTTCACCGTGTTAGCCAGG ACGTTGGATGACATGGTGGCTCACGCCTGTA 5030371 ACGTTGGATGACTGGGATTACAGATGTGAG ACGTTGGATGGTGCTTAAAAGGGATGAAT- C 5030372 ACGTTGGATGGTACATAAGCAGGAGGTTTC ACGTTGGATGTCTGTACAAACAACCATGAC 281433 ACGTTGGATGACAGAGTCGCTGTACATAAG ACGTTGGATGGTACAAACAACCATGACTAC 5030374 ACGTTGGATGTGTACAGCGACTCTGTCTAC ACGTTGGATGCTCTGAACCTCAGTTTCCTG 5030375 ACGTTGGATGTCTCCTACCTTTAATAGCCC ACGTTGGATGTTCTTTGCTGTGGGTAAGTG 5030397 ACGTTGGATGCTGGGTATCAAATGCAGGAC ACGTTGGATGAGAGTGAGAGTCTCTCTCAG 281434 ACGTTGGATGTAATCCCAACACTTTGGGGG ACGTTGGATGAACACCACGCCTGGCTAATT 12462944 ACGTTGGATGTTTCACTATATTGGCCAGGC ACGTTGGATGTGTAATCCCAACACTTTGGG 5030398 ACGTTGGATGCCACACGCAGCCTTTTTGTT ACGTTGGATGGAACTGTGATCATGCCACTG 5030378 ACGTTGGATGAGGCTTGTCTTGAACTCCTG ACGTTGGATGTGATGGCTCAGGCTGTAATC 12459133 ACGTTGGATGAAAGTGCTAGGATTACAGCC ACGTTGGATGTAAATGAGCCTGGCCTAGAC 5030399 ACGTTGGATGAGGTCCACTTCACCAGACAC ACGTTGGATGTAAGGTTCTTGCCCACTGGC 5492 ACGTTGGATGACCGTGGTCGTGACCTCAG ACGTTGGATGAACCTCACCGTGGTGCTGCT 1800019 ACGTTGGATGACAGCCCGTCCAGGGAACA ACGTTGGATGTCCTAGAGGTGGA- CACGCA 1799969 ACGTTGGATGTCAACCTCTGGTCCCCCAGTG ACGTTGGATGAGGGGACCGTGGTCTGTTC 5493 ACGTTGGATGTCCTAGAGGTGGACACGCAG ACGTTGGATGTGGACCTGGGCCTCCGAGACT 5030381 ACGTTGGATGTATGGCAACGACTCCTTCTC ACGTTGGATGTATTACTGCACACGTCAGC- C 5494 ACGTTGGATGTAAGGCCTCAGTCAGTGTGA ACGTTGGATGAGTATTACTGCACACGTCAG 3093033 ACGTTGGATGAAAGCCTGGAATAGGCACAC ACGTTGGATGTGCAGACAGTGACCATCTAC 5495 ACGTTGGATGTCACACTTCACTGTCACCTC ACGTTGGATGTGTGCCTATTCCAGGCTTTC 1801714 ACGTTGGATGCTAGAGCCAAGGTGACGCTG ACGTTGGATGTGGCCTTCAGCAGGAGCTGG 2071441 ACGTTGGATGAGCTTCTCCTGCTCTGCAAC ACGTTGGATGTCACACAGGACACGAAGCTC 5496 ACGTTGGATGAAGGTCTTGCCTCCAAGTCC ACGTTGGATGACAATCCCTCTCGTCCAGTC 5497 ACGTTGGATGCTCCATGTCATCTCATCGTG ACGTTGGATGAATTTTCTGGCCAC- GTCCAG 5030382 ACGTTGGATGCTCACAGAGCACATTCACGG ACGTTGGATGAGATCTTGAGGGCACCTACC 5030400 ACGTTGGATGGGACCTAATGCAATCCTCAC ACGTTGGATGGCTACCACAGTGATGATGAC 2071440 ACGTTGGATGACTGCCACCAATATGGGAAG ACGTTGGATGAAACCGAACACACAAGCCAC 5499 ACGTTGGATGGGAAGACATATGCCATGCAG ACGTTGGATGATCTGACTGAGGACAATGCC 3093032 ACGTTGGATGGGCCACTTCTTCTGTAAGTC ACGTTGGATGCATGAGGACATACAACTGGG 1057981 ACGTTGGATGGTACAACTGTACCTGGTGAC ACGTTGGATGAATGAACATAGGTCTCTGGC 5500 ACGTTGGATGTTGTACAGGTTGTACACTGC ACGTTGGATGAGGTTGGCCAATGAGAAGTC 5501 ACGTTGGATGCTGTGAACCATTACCAGTCC ACGTTGGATGACTTCTCATTGGCCAACCTG 5030383 ACGTTGGATGATATTCCCTGGGCACTCATG ACGTTGGATGTCCCCACCCACATACATTTC 281436 ACGTTGGATGCATGGTTCACTGCAGTCTTG ACGTTGGATGTGTGGTGTTGTGAGCCTATG 923366 ACGTTGGATGAGGAAGTCTGGGCAATGTTG ACGTTGGATGATAGGCTCACAACACCACAC 281437 ACGTTGGATGATAGGCTCACAACACCACAC ACGTTGGATGAACACAAAGGAAGTCTGGGC 3093030 ACGTTGGATGAGAGACCCAGAAGGTCATAG ACGTTGGATGCCTCCCCCAAGAAAACATTG 5030384 ACGTTGGATGTGCGCAGGAAAAACACGCTG ACGTTGGATGACTGTCAACTACCCTTCCCC 5030385 ACGTTGGATGATTAGGAACGGAACACAGGG ACGTTGGATGAGAGAGTTATGACCCCGAGA 3810159 ACGTTGGATGTTGCGATCACTTTCTCCAAG ACGTTGGATGCTGAGTGAGGAAACCTCAGG 281438 ACGTTGGATGACCTGAGGTTTCCTCACTCAG ACGTTGGATGAGAGGTTTCTGTGACACCCG 3093029 ACGTTGGATGGGCAGCTCTGATTGGATGTT ACGTTGGATGCTCCACAGTTGTTTGGCCT- C 2735442 ACGTTGGATGATGCTTTTGACTCCGCTTCC ACGTTGGATGATGTTCTGGTAGTCACCCAG 2569693 ACGTTGGATGCTTGTTCTCGCGTGGATGTC ACGTTGGATGTACTCAGCGTGTGTGAGCTC 281439 ACGTTGGATGGCGGAGCCATACCTCTAAGC ACGTTGGATGTCGCTGGCACTTTCGTCCC 281440 ACGTTGGATGCTGGCTGAGATGCCATGATA ACGTTGGATGATGGTGGGAGGAGCTAAATG 2569694 ACGTTGGATGCGCCCCCTCCTTGGAAACC ACGTTGGATGGCGCGGCGGGTGGGGTGTG 11575073 ACGTTGGATGGCTCTTCGGCCTCTCAGGT ACGTTGGATGAGGCCGTTTCTCAGGTCCAG 2569695 ACGTTGGATGAGTCCCTGGACCTGAGAAAC ACGTTGGATGAGAAGACTCAGGCTCGAGGT 2075741 ACGTTGGATGAAGATGCCAGTCCGTGGACC ACGTTGGATGAGTGTCTCTCCTGTCCGCTC 11575074 ACGTTGGATGTACCTCCTTACGCTGTGCTG ACGTTGGATGAGTTGGAGAGATGGAGTCT- T 2569696 ACGTTGGATGAACTACCCTGACTCAGAGGC ACGTTGGATGCTGGGCTCATGGAAGGAACC 2735439 ACGTTGGATGTTCCTTCCATGAGCCCAGCC ACGTTGGATGGGTCAAGGATCAGGAAGGAC 2569697 ACGTTGGATGTGTCTCTGGGACGTGGTAGC ACGTTGGATGTTTCCTCTCCTCTACGCCCT 2075742 ACGTTGGATGAGCCAGGGAAAGAACCCAGG ACGTTGGATGTTTAGACTCTGGGAGTGCGC 2569698 ACGTTGGATGTTTAAACCGGAGGCCTGGGC ACGTTGGATGTCAAGGGTTCTCAGAGGGCG 11669397 ACGTTGGATGGGCTGAATTGCAGCACCAAC ACGTTGGATGAACCAACGCAAACCCCTCT- G 901886 ACGTTGGATGATCAGCTCTACGCGATCTGG ACGTTGGATGTTCAGGCCCCACCTTCTGTTC 885742 ACGTTGGATGCCTAAGCACTTGACATGCAC ACGTTGGATGATGCTGACCCCGACTTCAAC 2569699 ACGTTGGATGAATGCTGACCCCGACTTCAA ACGTTGGATGGCACTTGACATGCACTATCT 11549918 ACGTTGGATGTTTTCGCCCCCCAGGGTGAC ACGTTGGATGACAGCCACAGCTAGCGCAGA 2569700 ACGTTGGATGGGGACCTCAGTACCGGAACA ACGTTGGATGCTCCCCAGCGATTACGTCTC 2228615 ACGTTGGATGGGGCAGATGGTGACAGTAAC ACGTTGGATGTGGAACTCCCTCCAGTGTGA ICAM-AA ACGTTGGATGACCTTCTGGTGACTTCCAAG ACGTTGGATGAGACGTAAGAAATGGCTCCG 2569701 ACGTTGGATGCCAGACCTTGAACCAGATAG ACGTTGGATGTCAAGGACGTAACGCTAACG 2569702 ACGTTGGATGACCCTCCAGACCTTGAACCA ACGTTGGATGACGTAACGCTAACGGTGGAG 2735440 ACGTTGGATGTAGTCGAGCCATGCACTCTG ACGTTGGATGGGCAGTCCAGAGTGTTTAAG 2569703 ACGTTGGATGTCAGGAAGCTCCCAGACAGA ACGTTGGATGATAACCCTTGGACGCCGATC 10418913 ACGTTGGATGCCAAAGCCAACAATACACTC ACGTTGGATGCAGCCAAGTAATGCGTTCT- G 1056536 ACGTTGGATGATTCTGGGAGCTCTGGGACT ACGTTGGATGAGCCAAGCGTGAAGTGCGTG 2569704 ACGTTGGATGGATTCATCCATCTCCGGTGG ACGTTGGATGTCCAGGCACTCCCTGACATC 11673661 ACGTTGGATGAAGCGATTCTCCTGCCTCAG ACGTTGGATGTGGCGAAAACCCGTCTCTA- C 10402760 ACGTTGGATGAAGAGGATCCTGCCTCCTAT ACGTTGGATGGAAGGGCGAGGAATTTTAGC ACGTTGGATGTGCGCCCAGGAGGAA- ACTTC ACGTTGGATGCAGCTGATCTGGGCTGGAG 2569706 ACGTTGGATGCTGTTGTTGCTCGACAGGCC ACGTTGGATGTGGCCTCCAGCCCAGATCA 2569707 ACGTTGGATGTGAGCGTGGCAGGCGCCATG ACGTTGGATGGCGTGGCGCCCGTGCGCGT 2436545 ACGTTGGATGGGCGCATCACGGTGCGCGT ACGTTGGATGAAGACCCAGGTCACGCCCCC 2436546 ACGTTGGATGTCTCAGATACCTCGCCCCGC ACGTTGGATGCGCATCACGGTGCGCGTGG 2916060 ACGTTGGATGGGCGAGGTATCTGAGAGGG ACGTTGGATGTACTCTGTCCCACTTCCGTC 2916059 ACGTTGGATGGGGCGAGGTATCTGAGAGG ACGTTGGATGCTTTGACTTCTACTCTGTCC 2916058 ACGTTGGATGTCAAAGTGCGATCAACAGCC ACGTTGGATGCTCTCGGTCCCGGTAGACT 2569708 ACGTTGGATGCGGTAGACTAGACGGAAGTG ACGTTGGATGAAAGTGCGATCAACAGCCCC 735747 ACGTTGGATGATCTTCCCCACAGTGGATTG ACGTTGGATGACTGCTGCAGGAAAGGACTT 885743 ACGTTGGATGTGAGAGAAGGCGATCTTGAC ACGTTGGATGCCAATTCACAATCCACTGTG 710845 ACGTTGGATGAGGCCGAGAGCTCAGGCGAG ACGTTGGATGTCGGGTCCGCCCTCCGCGCCT 2569709 ACGTTGGATGTATTCAACTCCAAGGGCGTC

ACGTTGGATGAGAAACAGAAGCGGAGACAG 2569710 ACGTTGGATGACCCCCATTTTCTACCCATC ACGTTGGATGTTGCAGAAACAGAAGCGGAG 2569711 ACGTTGGATGTGTCTCCGCTTCTGTTTCTG ACGTTGGATGTGAATAACTCGGGAGGTCAC 2569712 ACGTTGGATGACCCCAGGCCCTCTCAAAAA ACGTTGGATGTCTGCAAGGTGGAACAAGCC 12610026 ACGTTGGATGCGGTGGCTCATGCGTGTAAT ACGTTGGATGCTCCCGAATAGCTGGGACTA 4804129 ACGTTGGATGTAACACGGTGAAACCCCGTC ACGTTGGATGTGAGTAGCTGGGACTACAGG 12150978 ACGTTGGATGAGACAGCAAGACTCCGTCTC ACGTTGGATGCCCGCCTTAGTTTCCCAAAG 439843 ACGTTGGATGTGGCTAACATGGTGAAACCC ACGTTGGATGTTGAGTAGCTGGGACTACAG 892188 ACGTTGGATGGTTTGTTTTTAGAGACAGGG ACGTTGGATGGTCAAAGCCACTTCCAGCTA 2291473 ACGTTGGATGAAGAGGCTATGTGGCAGATG ACGTTGGATGAGGGTGAAGCTGGGTTTAAC 281416 ACGTTGGATGTAACGTAGAGCACAGGTGAG ACGTTGGATGCAACGCAAACACCAGTGTGG 281417 ACGTTGGATGAAGAGACAGTGGAGAGGCTG ACGTTGGATGAGAGCCATCGGGTCCCAGCAA 882589 ACGTTGGATGTCGATAACCCCAGCAAAGAG ACGTTGGATGTAAGGCCAAACCCCATTCCC 1048941 ACGTTGGATGAGATTGTGCTGACACCGGAG ACGTTGGATGCCACGTAGAAGTTCCTGGTG 281418 ACGTTGGATGTGCGCTCAGTCAGCTTCCTC ACGTTGGATGAGTGTTAGCCGAGGGCAAGC 430092 ACGTTGGATGGTTGGGATTACAGGCATGAG ACGTTGGATGATCTGTTGCCTGTCAAGATG 368835 ACGTTGGATGGGTGGGAAAAAGACGTGAAG ACGTTGGATGAGAGGGAATTAAGGAGGTCC 2358583 ACGTTGGATGAAGACGTGAAGAGACACACC ACGTTGGATGAGAGGGAATTAAGGAGGTCC 378395 ACGTTGGATGACTTGGCCCCCTGCACTCACA ACGTTGGATGACCGTGTTTTCCAGGCTCGCG 395782 ACGTTGGATGATGCATGTCATGGCCGCCTC ACGTTGGATGTTCCACCAGGTGCCCCTGGCA 1045384 ACGTTGGATGTTCAACAAGCGAGTGACAGC ACGTTGGATGGTGCAGAGATGGGCTTTCT- C 281427 ACGTTGGATGGACAATTGTAGTACCCAGCC ACGTTGGATGAGGAGAATCGCTTGAACCTG 3745264 ACGTTGGATGCAAAGTGCTAGGATCACAGG ACGTTGGATGACTGCCCCATAGAGTGGCAA 281426 ACGTTGGATGATCCTCACACCTCAGTCTCC ACGTTGGATGAATGAGACTCCGTCTCTACC 281425 ACGTTGGATGCCAGCGGCCCAGCTCACTC ACGTTGGATGTCTGAGGCCAGAGCCTCGGA 281424 ACGTTGGATGACCTGTGTTTCTAGGTGTGC ACGTTGGATGCATGCCTGGGAAAAAACTCC 281423 ACGTTGGATGAACCTCAAGCTGCTTCACTG ACGTTGGATGGAGGAGCCCACCTTTAATGT 281422 ACGTTGGATGAGAAATCCTCCTACCTTGGC ACGTTGGATGGCCCGGCCTCTACATAAAAT 281420 ACGTTGGATGCCAGGACTGTCTCTCTGTTT ACGTTGGATGATGACACTACAGCCTGAGCA 3745263 ACGTTGGATGTACATGAAGAAGGACTCGGC ACGTTGGATGATCCGTCCAGTGCACGTAGA 3745262 ACGTTGGATGGCAGCCGAGTCCTTCTTCAT ACGTTGGATGTTCCTGGTCTACAGTGAGCG 3745261 ACGTTGGATGACACACAGCAGGGCATCCGT ACGTTGGATGCGCAATCAATGCTTTCCACC 3181049 ACGTTGGATGATCTTCAGGGATGGTCACTC ACGTTGGATGGACAAATACAAAGGGACAGG 281412 ACGTTGGATGTGACCTCAGGTGATTCACCC ACGTTGGATGGGTATACCTTTAGCTGGCTG 3181048 ACGTTGGATGCTTTTCTCCACCCACTCTAC ACGTTGGATGTAAACGCGTGATATGGAGGG 2230399 ACGTTGGATGAGCGGCAGTTACCATGTTAG ACGTTGGATGTTCTTCCCCCATTGCTTCTG 2278442 ACGTTGGATGGGTGATGGACATTGAGGGTG ACGTTGGATGTCCCTTCTGTCTCCAACCC 3181047 ACGTTGGATGGAATGCGACAGTCATGAACC ACGTTGGATGCCCCTAGGGTCACGTTGCA 3181046 ACGTTGGATGTATCTTGCTGACTGGGTCAC ACGTTGGATGCGTGGGATCTTTGAAGAAGG 2304237 ACGTTGGATGTGGGCCAGAACTTCACCCTG ACGTTGGATGAAGCAGCACCACCGTGAGG 281413 ACGTTGGATGTCAAAGCTCACAGTTCTCGG ACGTTGGATGACTTAGCGGGTCCTGCAAAC 1058154 ACGTTGGATGTCCCTTCCATCCTCATTTTT ACGTTGGATGTGCAAGGCGCTAAACAAAAC 3176769 ACGTTGGATGTTCCTGTTTATGGCCAGACG ACGTTGGATGGTCTGAACCTGATTGGAGAG 2304238 ACGTTGGATGCCTGGACATTTGTGTGTGAG ACGTTGGATGCATGAGATTGAGATGCGTC

2304239 ACGTTGGATGCAGGCTCCTCTAACATCACC ACGTTGGATGACACCACTACCCAAGACCAG 2304240 ACGTTGGATGAATCTCAGCAACGTGACTGG ACGTTGGATGACACGGTGATGTTAGAGGAG 3176768 ACGTTGGATGGAGAGGTGTTAAATGGTGGG ACGTTGGATGGGAACATGAAGAAGTCCTGG 3176767 ACGTTGGATGCGGTCTCTGATGGATTCTAC ACGTTGGATGAACAGGCCCCACCATTTAAC 3176766 ACGTTGGATGTTTCGGGCTGCAATGGTCCC ACGTTGGATGTAACACCTCTCTCCTTGTGC 281414 ACGTTGGATGAAGGCACCTTCCTCTGTCAG ACGTTGGATGTGGGCCACAACACGGATGGTA 281415 ACGTTGGATGGCACAAAGAGCTAAGGTAGG ACGTTGGATGGAATCCTGGATAGACAGTGG

[0292]

16TABLE 11 dbSNP rs# Extend Primer Term Mix 2884487 AGAGACAGGGTCTCGCC ACT 2358580 TCATCCAGCGGCGCCTCGC ACT 2304236 GCCCTGGGTAGCGTGGGG ACT 1059840 GCTCAGAAGAGGTGCTTCAC CGT 1059843 CTGTTGATGTGAAGCACCTCTT ACG 11115 AAGGGTGGGCGTGGGCCT ACT 1059849 CAGAAGCCCGTCTGGGCT ACG 1059855 AAAAAGAGGGAATGGATGCA ACT 5030386 CCTGGGCTCAAGTGATCCT ACT 5030339 GCTGGGATTACAGGTGGGA ACT 5030387 TTGTGGCTGCAAGTGGGAC ACT 5030388 CGCGCCCCACAACAGGAAA ACT 1799766 GCGGAGCCTGGGACGCC CGT 5030389 GCGCCGAGCCCCTCCGC ACT 5490 CTACTCAGAGTTGCAACCTC CGT 11575070 CCTGCCTCAGCCTCCCGA ACT 5030340 GCGTCTCTTACAGTTTCTCAG ACG 5030390 CCAAAGCTGAGAAGTGGGAC ACT 5030391 GGGGAACCAGGAGGGTGG ACT 3093035 TTCTGTCTCAAAAAACAAAGC ACT 11667983 CCTTCGGAGGCAGCAGAAT ACG 5030341 TTTTTGAGACGGAGTCTCACT ACT 5030342 GACGGAGTCTCACTCTGTC ACT 5030343 GCTACTCAGGGAGGCTGAG ACT 5030344 CTCCTCACTCCCTGAGACA ACG 5030347 CTGCCTCCCGGGTTCAAGT ACT 5030348 CACTTGAACCCGGGAGGCA ACT 5030349 CAGACTGGAGTGCAGTGGC ACT 5030350 TGCTAAAGATGTGTTCTTTTATTT CGT 5030351 GAAGAAACGAGGGAAGAGGC ACT 5491 CCTCCTGTGACCAGCCCA CGT 5030352 CTGCACGTCTCTCCCACC ACT 5030353 GGTGGGAGAGACGTGCAG ACT 10420063 CGCCCGGCCATCAATTCTTT ACG 11879117 CCCTCAGCCTCCCAAAGTG ACT 5030354 TGTCATTTCTCCCACTTCCTT ACT 5030355 CAGGAGGTGAAGGTTGCGG ACT 281428 GCGCCCAGCACCACGCC ACG 5030358 CAGGAGATCAAGACCAGCC ACG 5030359 AGCCACTGCCCCCAGCC ACT 5030392 GTCCCCAAAGTAGGAAGGAC ACT 5030393 AGGTGGGAGGATCACCTGA ACT 5030360 CTCCAGCCTGGGTGACAGA ACT 5030394 CAGGTGAGGGAAGTCCCC ACT 281429 GACTGTGTGTCAAAAAAAA ACT 5030361 TATCAGGCAGAGCCGCGC ACT 5030362 AGAGGGAGAAATGTGGCAGA ACT 281430 GAGCCACTGCACCTGGCC ACG 281431 ACAGGTGTGAGCCACTGC ACT 5030395 GGCTCAAGTGGGAGGATCA ACG 5827095 CCATCAATCAATTTTTTTTTTTTTTT CGT 281432 CTAATCCCTGGCCTGCTCA ACT 5030364 GGACCATAGCCAACTGCTC CGT 5030365 GGTCAGAGTTTTCTTGACTATAT ACT 5030368 GAGACCAGCCTGACCAACA ACG 5030369 TCATCTGAGGTTGGGAGTTC ACT 3073809 CGGCCTTTTTTTTTTTTTTTTTTTTT ACT 2358581 CTTGCAGTGAGCCCAGATCG CGT 7258215 CGTGTTAGCCAGGATGGTCT ACG 5030371 AGCCTVGCTTTCTTGAGATAC ACT 5030372 GGTTTCTTTTTTAGAGTGATTGA ACT 281433 GTACATAAGCAGGAGGTTTCTT ACT 5030374 CTCTGTCTACCTCTTAAGTGA CGT 5030375 GTTCAGGAAACTGAGGTTCAG ACT 5030397 CAAATGCAGGACCCCCCC ACT 281434 TCAAGACCAGCCTGGCCAA ACG 12462944 ATATTGGCCAGGCTGGTCTT ACT 5030398 CAGGGTCTTTCTTTCCCAGG ACT 5030378 CCTGGCCTCAAGTGACCCT ACT 12459133 CTGGCCAACAGGTTTTTTTTTTT ACT 5030399 CCCCCACCTCTGTTTTCCT ACT 5492 CTGGCTCCCGTTTCAGCTC ACT 1800019 CGTCCAGGGAACAGACCAC ACT 1799969 CCGAGACTGGGAACAGCC ACG 5493 GGTCTGTTCCCTGGACGG ACT 5030381 AGGCCTCAGTCAGTGTGAC ACG 5494 TCAGTGTGACCGCAGAGGA ACG 3093033 GGGTTCAGGTCACACCC ACG 5495 CTCTGGCTTCGTCAGAATCA ACG 1801714 CCAGCCCAGCCACTGGGCC ACG 2071441 CGGCCAGCTTATACACAAGAA ACG 5496 CACCTCCATGTCATCTCATC ACT 5497 GTTTTTCCAGATGGCCCCC ACT 5030382 CAGAGCACATTCACGGTCACCT ACG 5030400 TCCTCCCCACAGCCCCC ACG 2071440 GAGGAAGAGGCCCTGTCC ACG 5499 GCCATGCAGCTACACCTAC ACG 3093032 CTTCTGTAAGTCTGTGGG ACT 105798 TTACCTGGTGACCTTGAATGTGAT ACG 5500 GAGTGCCTGGCAAAAAGATCA ACT 5501 CCATATAGTGCTTTTGTGCCG ACT 5030383 ACTCATGTCCAGACATGACC ACT 281436 ACTGCAGTCTTGACCTTTTG ACT 923366 TGCGAGACCCCGTCTCTG ACT 281437 TTTTTTTTCCAGAGACGGGGTCT ACG 3093030 CCAGAACCTCAGGGTATG ACT 5030384 ATCACCGCCTACAGTGAGG ACT 5030385 AGGGAGGTCTGTCGACCC ACT 3810159 CCAAGTTCCTTGTCTCCCT ACT 281438 CGAAGCCCCAGACTCTGTGTA ACT 3093029 AGTTTCCTATCCCAGCC ACT 2735442 GCTTTGACACCCCCCACC ACT 2569693 CGCGTGGATGTCAGGGCC ACG 281439 ACCCCTCCGGGTCAGCTCC ACT 281440 TAATAAGCTGGACTCCGAGC ACG 2569694 ATCCCCAAGCGCAACTCTG ACG 11575073 CGGCCTCTCAGGTAAGAGC ACG 2569695 CTCTGCCCTCGCCTCGCT ACT 2075741 GTGGACCATGGTGCACAGCA ACT 11575074 CTGTGCACCATGGTCCACG ACT 2569696 TGTTCCCGCTCCACCCAGA ACT 2735439 CAGCCTTGCGTCCCGGC ACT 2569697 GGGACGTGGTAGCAGAGAG ACT 2075742 AACCCAGGCGTCCCGCGTC ACT 2569698 TGGGTTCTTTCCCTGGCTG ACT 11669397 TTGCAGCACCAACTGCCCT ACG 901886 AGAGTCCGCAGCTCTTTGAAC ACT 885742 TGCACTATCTTATCGTATTATCA ACG 2569699 CCCTCCGTGCCTTGAGGA ACT 11549918 CCCAGGGTGACGTTGCAGA ACG 2569700 TCAGTACCGGAACAGGCGTG ACT 2228615 AGTAACCTGCGCAGCTGGG ACT ICAM-AA TCCAAGGACCCGCCTGCT ACG 2569701 CTTGAACCAGATAGAAATGCAC ACG 2569702 CAGACCTTGAACCAGATAGAA ACT 2735440 ACCAGTGGCGCCTTTTTCG ACG 2569703 CTCCCAGACAGAGTGCATG ACT 10418913 GCACCAGCGCTGGACAGC ACT 1056536 GCAGCAGCACCCCCTCAGTGG ACG 2569704 CTCCGGTGGCGCTGCAAA ACT 11673661 GGACCACAGGCGCCCAC ACT 10402760 CTCCTTCCCCGACAATCAG ACT CACGTTGACCTGCCGCGC ACT 2569706 GGCCGATGTTGAGGGCCC ACG 2569707 GGCGAGTACGAGTGCGCA ACT 2436545 ACGGTGCGCGTGGCCGGT CGT 2436546 CCTCTCCCCAGCTGCCAC ACT 2916060 CTCCCTCTCGGTCCCGG ACT 2916059 CGGTCCCGGTAGACTAG ACT 2916058 TTCTACTCTGTCCCACT CGT 2569708 CTAGACGGAAGTGGGACAGA ACT 735747 TGTGAATTGGGTCAAGTTTCC ACT 885743 GACCCCTCTCTCCCTCCA CGT 710845 AGGCGAGGCCGTGTGTCT ACT 2569709 GGCGTCACCCCCATTTTCTA ACT 2569710 TTTCTACCCATCCCCTCAATA ACT 2569711 GTTTCTGCAAGGTGGAACAAG ACT 2569712 GGCCCTCTCAAAAATCGCTT CGT 12610026 AGCTGGGCATGGTGGTGC ACT 4804129 AAACCCCGTCTCTACTAAAAAT CGT 12150978 GCCAGGGCCGAGCACAGT ACT 439843 ATGGTGAAACCCCGTCACTA CGT 892188 TGGGCTGGAGCACAATGAC ACT 2291473 GGAGTGTCCCTGGACCCC ACT 281416 GGTCCACACCGACGCCAG ACT 281417 CCCCTGCCCAGGACACCCC ACT 882589 CCCCAGCAAAGAGAGGTCAT ACT 1048941 GGAAGGAGCGGAATTCACCCT ACT 281418 TCAGCTTCCTCCCTCCCC ACT 430092 ATTACAGGCATGAGCCACTG ACG 368835 AGACGTGAAGAGACACACCT ACT 2358583 AAGAGACACACCTAATTTGTGG ACT 378395 GCCCGCGTCCTCCTCTCC CGT 395782 GCGTGAGTGCCAGGGTTCT ACT 1045384 ACAATGTCCGACTCCCACA ACT 281427 CTTTGTATACAATCTTCCCTC ACG 3745264 ATACCATGCCAGGCATT ACT 281426 GAGCTGGGACCACAGGCA ACG 281425 CCAGCTCACTCCTCCCCC CGT 281424 TAGGTGTGCGTGTGTGTGTG ACG 281423 GCCCACCCTCCATTCAGC ACG 281422 CTGGGGAACTACAGGAATGC ACT 281420 ACTGTCTCTCTGTTTTTGAGAT ACT 3745263 TCGGCTGCCCGTGCCAAGTC ACT 3745262 GAGTCCTTCTTCATGTACTC ACT 3745261 GCAGCTGCACCGACAGTTC ACT 3181049 ACTCCCTGCCCTGGCCC ACT 281412 GCTGGGATTATAAGCGTG ACT 3181048 TACCACAGGGTGGCGGG ACT 2230399 GTTACCATGTTAGGGAGGAGA ACT 2278442 GGACATTGAGGGTGAGCTAA ACG 3181047 CAGGAGGGTGCCCGGGA ACT 3181046 ACTGGGTCACCCTTCTTC ACT 2304237 TGCGCTGCCAAGTGGAGG ACT

281413 GCTCACAGTTCTCGGCAGGAC ACG 1058154 CTTCCATCCTCATTTTTTTTTATT ACT 3176769 CGGGGTGGGTGGATCAA ACT 2304238 CATTTGTGTGTGAGATACAAAGA ACG 2304239 ATCACCGTGTACAGTGAGTC ACT 2304240 GCTCAGTGTACTGCAATGGCTC ACG 3176768 TGTTGATGCGTGGGTTGGGG ACT 3176767 TGGATTCTACCTTTCCC CGT 3176766 TCCTTCTGAGTTCTCCC ACG 281414 CCTTCCTCTGTCAGAATGGC ACG 281415 GGTGATTTGGGGACAGCTGA ACT

[0293] Genetic Analysis of Allelotyping Results

[0294] Allelotyping results are shown for cases and controls in Table 12. The allele frequency for the A2 allele is noted in the fifth and sixth columns for breast cancer pools and control pools, respectively, where "AF" is allele frequency. SNPs with blank allele frequencies were untyped.

17TABLE 12 Breast Position in Cancer SEQ ID Chromosome A1/A2 Associated dbSNP rs# NO: 1 Position Allele Case AF Control AF p-Value OR Allele 2884487 230 10219830 T/C T = 0.788 T = 0.76 0.307 0.85 T C = 0.212 C = 0.240 2358580 4282 10223882 A/G A = A = 0.474 G = G = 0.526 2304236 11844 10231444 A/C A = 0.986 A = 0.995 0.335 2.92 C C = 0.014 C = 0.005 1059840 11890 10231490 A/T A = 0.19 A = 0.203 0.602 1.09 T T = 0.810 T = 0.797 1059843 11905 10231505 C/T C = 0.999 C = 0.999 0.96 1.26 T T = 0.001 T = 0.001 11115 11942 10231542 T/C T = 0.566 T = 0.634 0.0401 1.33 C C = 0.434 C = 0.366 1059849 12054 10231654 G/A G = 0.754 G = 0.804 0.0649 1.34 A A = 0.246 A = 0.196 1059855 12070 10231670 T/C T = 0.001 T = 0.003 0.838 3.25 C C = 0.999 C = 0.997 5030386 21497 10241097 C/G C = 0.999 C = 0.999 0.987 1.12 G G = 0.001 G = 0.001 5030339 21537 10241137 A/G A = 0.002 A = 0.002 0.993 0.93 A G = 0.998 G = 0.998 5030387 21682 10241282 T/G T = 0.999 T = 0.995 0.706 0.27 T G = 0.001 G = 0.005 5030388 22073 10241673 A/G A = 0.001 A = 0.001 0.968 3.66 G G = 0.999 G = 0.999 1799766 22393 10241993 C/-- C = 0.001 C = 0.002 0.952 1.46 -- -- = 0.999 -- = 0.998 5030389 22394 10241994 A/-- A = 0.983 A = 0.979 0.757 0.80 A -- = 0.017 -- = 0.021 5490 23227 10242827 C/A C = 0.001 C = 0.001 1 1.00 A = 0.999 A = 0.999 11575070 23614 10243214 C/G C = 0.001 C = 0.001 0.986 1.58 G G = 0.999 G = 0.999 5030340 23681 10243281 C/T C = 0.963 C = 0.967 0.829 1.13 T T = 0.037 T = 0.033 5030390 23937 10243537 A/G A = 0.191 A = 0.145 0.0748 0.72 A G = 0.809 G = 0.855 5030391 24037 10243637 A/G A = 0.012 A = 0.044 0.0373 3.95 G G = 0.988 G = 0.956 3093035 24373 10243973 A/G A = 0.113 A = 0.085 0.223 0.73 A G = 0.887 G = 0.915 11667983 24589 10244189 C/T C = 1.000 C = 0.998 0.84 0.36 C T = 0.000 T = 0.002 5030341 24675- 10244275{circumflex over ( )} CT/-- CT = 0.691 CT = 0.745 0.0746 1.30 -- 24676 10244276 -- = 0.309 -- = 0.255 5030342 24680 10244280 T/G T = 0.373 T = 0.389 0.634 1.07 G G = 0.627 G = 0.611 5030343 24754 10244354 T/C T = 0.674 T = C = 0.326 C = 5030344 25053 10244653 G/A G = 1.000 G = 1.000 0.952 0.35 G A = 0.000 A = 0.000 5030347 26004 10245604 A/C A = 0 A = 0 1 C = 1.000 C = 1.000 5030348 26023 10245623 A/G A = 0.076 A = 0.072 0.843 0.95 A G = 0.924 G = 0.928 5030349 26046 10245646 T/C T = 0.832 T = 0.819 0.618 0.92 T C = 0.168 C = 0.181 5030350 26100 10245700 A/T A = 1.000 A = 1.000 1 T = 0 T = 0 5030351 26817 10246417 T/C T = 0.002 T = 0.002 0.998 1.02 C C = 0.998 C = 0.998 5491 26940 10246540 T/A T = 0.001 T = 0.002 0.853 3.82 A A = 0.999 A = 0.998 5030352 27143 10246743 G/C G = 0.631 G = 0.62 0.732 0.96 G C = 0.369 C = 0.380 5030353 27162 10246762 A/G A = 0.002 A = 0.004 0.858 2.12 G G = 0.998 G = 0.996 10420063 28328 10247928 G/A G = 0.001 G = 0.002 0.864 6.56 A A = 0.999 A = 0.998 11879117 28799 10248399 G/C G = 0.998 G = 1.000 0.844 3.03 C C = 0.002 C = 0.000 5030354 29166 10248766 A/C A = 0.999 A = 1.000 0.989 1.15 C C = 0.001 C = 0.000 5030355 29331 10248931 A/C A = 0.999 A = 0.999 0.985 1.12 C C = 0.001 C = 0.001 281428 29724 10249324 C/T C = 0.821 C = 0.823 0.951 1.01 T T = 0.179 T = 0.177 5030358 29773 10249373 G/A G = 0.006 G = 0.007 0.966 1.12 A A = 0.994 A = 0.993 5030359 29862 10249462 A/G A = 0.001 A = 0.003 0.858 4.75 G G = 0.999 G = 0.997 5030392 29877 10249477 T/C T = 0.002 T = 0.001 0.958 0.59 T C = 0.998 C = 0.999 5030393 30194 10249794 T/G T = 0 T = 0.005 0.836 G G = 1.000 G = 0.995 5030360 30258 10249858 T/G T = 0 T = 0.001 0.972 G G = 1.000 G = 0.999 5030394 30549 10250149 A/G A = 0.005 A = 0.006 0.926 1.23 G G = 0.995 G = 0.994 281429 30648 10250248 T/C T = 0.999 T = 1.000 0.938 2.63 C C = 0.001 C = 0.000 5030361 30909 10250509 T/C T = 0.002 T = 0.002 0.989 1.10 C C = 0.998 C = 0.998 5030362 30962 10250562 A/C A = 0.004 A = 0.002 0.791 0.29 A C = 0.996 C = 0.998 281430 31337 10250937 G/A G = 0.015 G = 0.008 0.498 0.51 G A = 0.985 A = 0.992 281431 31345 10250945 T/C T = T = 0.886 T C = C = 0.114 5030395 31534 10251134 C/T C = 0.998 C = 0.998 0.973 1.11 T T = 0.002 T = 0.002 5827095 31942 10251542 A/-- A = 0.532 A = 0.532 0.986 1.00 A -- = 0.468 -- = 0.468 281432 32058 10251658 G/C G = 0.51 G = 0.553 0.194 1.19 C C = 0.490 C = 0.447 5030364 32109 10251709 A/T A = 0.001 A = 0.002 0.902 4.40 T T = 0.999 T = 0.998 5030365 32401 10252001 A/G A = 1.000 A = 1.000 1 1.03 G = 0.000 G = 0.000 5030368 32845 10252445 G/A G = 0.099 G = 0.097 0.901 0.97 G A = 0.901 A = 0.903 5030369 32864 10252464 T/C T = 0.506 T = 0.487 0.541 0.92 T C = 0.494 C = 0.513 3073809 32965- 10252565{circumflex over ( )} TT/-- T = 0.848 T = 0.859 0.69 1.10 -- 32966 10252566 -- = 0.152 -- = 0.141 2358581 33011 10252611 G/T G = 0.904 G = 0.919 0.525 1.20 T T = 0.096 T = 0.081 7258215 33170 10252770 C/T C = 0.85 C = 0.847 0.88 0.97 C T = 0.150 T = 0.153 5030371 33516 10253116 A/G A = 0.001 A = 0.001 0.969 0.58 A G = 0.999 G = 0.999 5030372 33608 10253208 T/C T = 1.000 T = 1.000 0.997 1.08 C C = 0.000 C = 0.000 281433 33623 10253223 A/C A = 1.000 A = 1.000 0.989 1.34 C C = 0.000 C = 0.000 5030374 33672 10253272 C/A C = 0.156 C = A A = 0.844 A = 5030375 33724 10253324 A/-- A = 0.999 A = 1.000 0.94 2.17 -- -- = 0.001 -- = 0.000 5030397 33787 10253387 T/G T = 0.231 T = 0.18 0.0697 0.73 T G = 0.769 G = 0.820 281434 34020 10253620 G/A G = 0.932 G = 0.93 0.902 0.97 G A = 0.068 A = 0.070 12462944 34038 10253638 C/G C = 0.004 C = 0.006 0.888 1.32 G G = 0.996 G = 0.994 5030398 34190 10253790 C/G C = 0.959 C = 0.993 0.064 5.64 G G = 0.041 G = 0.007 5030378 34706 10254306 C/G C = 0.993 C = 0.995 0.918 1.25 G G = 0.007 G = 0.005 12459133 34778 10254378 T/G T = 0.376 T = 0.347 0.365 0.88 T G = 0.624 G = 0.653 5030399 35553 10255153 A/G A = 0.002 A = 0.001 0.922 0.23 A G = 0.998 G = 0.999 5492 35690 10255290 G/C G = 1.000 G = 1.000 0.993 0.00 G C = 0 C = 0.000 1800019 36173 10255773 A/C A = 0.002 A = 0.001 0.914 0.47 A C = 0.998 C = 0.999 1799969 36192 10255792 G/A G = 0.882 G = 0.849 0.134 0.75 G A = 0.118 A = 0.151 5493 36194 10255794 T/G T = 0.001 T = 0 0.99 0.00 T G = 0.999 G = 1.000 5030381 36308 10255908 C/T C = 0.877 C = T = 0.123 T = 5494 36317 10255917 C/T C = 0.999 C = 1.000 0.873 5.90 T T = 0.001 T = 0.000 3093033 36431 10256031 G/A G = 0.991 G = 0.969 0.113 0.30 G A = 0.009 A = 0.031 5495 36496 10256096 G/A G = 1.000 G = 0.999 0.888 0.19 G A = 0.000 A = 0.001 1801714 36608 10256208 C/T C = 0.995 C = 0.98 0.129 0.25 C T = 0.005 T = 0.020 2071441 36708 10256308 C/T C = 1.000 C = 1.000 0.993 1.25 T T = 0.000 T = 0.000 5496 36847 10256447 A/G A = 0.003 A = 0.009 0.469 4.06 G G = 0.997 G = 0.991 5497 36868 10256468 A/G A = 0.004 A = 0.006 0.813 1.61 G G = 0.996 G = 0.994 5030382 37083 10256683 G/A G = 0.449 G = 0.512 0.0484 1.29 A A = 0.551 A = 0.488 5030400 37196 10256796 C/T C = 1.000 C = 0.999

0.969 0.76 C T = 0.000 T = 0.001 2071440 37373 10256973 G/A G = 0.999 G = 1.000 0.875 5.74 A A = 0.001 A = 0.000 5499 37465 10257065 C/T C = 0.994 C = 1.000 0.47 8.13 T T = 0.006 T = 0.000 3093032 37736 10257336 T/C T = 0.322 T = 0.267 0.0662 0.77 T C = 0.678 C = 0.733 1057981 37959 10257559 G/A G = 0.032 G = 0.026 0.693 0.80 G A = 0.968 A = 0.974 5500 38031 10257631 A/G A = 0.995 A = 0.996 0.868 1.35 G G = 0.005 G = 0.004 5501 38091 10257691 T/C T = 1.000 T = 0.999 0.862 0.06 T C = 0.000 C = 0.001 5030383 38243 10257843 T/C T = 0.002 T = 0.001 0.964 0.58 T C = 0.998 C = 0.999 281436 38531 10258131 A/G A = 0.501 A = 0.452 0.132 0.82 A G = 0.499 G = 0.548 923366 38623 10258223 T/C T = 0.517 T = 0.562 0.161 1.20 C C = 0.483 C = 0.438 281437 38638 10258238 C/T C = 0.804 C = 0.852 0.0793 1.39 T T = 0.196 T = 0.148 3093030 38803 10258403 T/C T = 0.553 T = 0.606 0.137 1.24 C C = 0.447 C = 0.394 5030384 39489 10259089 A/G A = 0.001 A = 0.001 0.988 0.80 A G = 0.999 G = 0.999 5030385 40008 10259608 G/C G = 0.002 G = 0.002 0.974 0.79 G C = 0.998 C = 0.998 3810159 40711 10260311 T/C T = 0.001 T = 0.001 0.915 68.31 C C = 0.999 C = 0.999 281438 40775 10260375 T/G T = 0.767 T = 0.802 0.31 1.23 G G = 0.233 G = 0.198 3093029 40951 10260551 C/G C = 0.912 C = 0.92 0.683 1.11 G G = 0.088 G = 0.080 2735442 41218 10260818 G/C G = 0.999 G = 0.999 0.97 0.79 G C = 0.001 C = 0.001 2569693 41304 10260904 C/T C = 0.703 C = 0.641 0.0479 0.75 C T = 0.297 T = 0.359 281439 41510 10261110 G/C G = 0.471 G = 0.418 0.111 0.81 G C = 0.529 C = 0.582 281440 41704 10261304 G/A G = 0.268 G = 0.255 0.676 0.94 G A = 0.732 A = 0.745 2569694 42020 10261620 C/T C = 0.999 C = 0.999 0.972 1.20 T T = 0.001 T = 0.001 11575073 42210 10261810 C/T C = 0.924 C = T T = 0.076 T = 2569695 42302 10261902 C/G C = 1.000 C = 0.998 0.815 0.02 C G = 0.000 G = 0.002 2075741 42498 10262098 G/C G = 0.715 G = 0.631 0.0112 0.68 G C = 0.285 C = 0.369 11575074 42520 10262120 A/G A = 0.088 A = 0.097 0.702 1.11 G G = 0.912 G = 0.903 2569696 42607 10262207 A/G A = 0.005 A = 0.004 0.909 0.69 A G = 0.995 G = 0.996 2735439 42674 10262274 T/G T = 1.000 T = 1.000 0.928 G G = 0.000 G = 0 2569697 42929 10262529 G/C G = 1.000 G = 1.000 0.97 3.84 C C = 0.000 C = 0.000 2075742 43007 10262607 G/C G = G = 0.638 G C = C = 0.362 2569698 43040 10262640 C/G C = 1.000 C = 1.000 0.98 G G = 0.000 G = 0 11669397 43246 10262846 C/T C = 1.000 C = 1.000 0.962 0.00 C T = 0 T = 0.000 901886 43531 10263131 T/C T = 0.667 T = 0.645 0.544 0.90 T C = 0.333 C = 0.355 885742 44023 10263623 G/A G = 0.012 G = 0.016 0.633 1.46 A A = 0.988 A = 0.984 2569699 44024 10263624 T/G T = 0.999 T = 1.000 0.962 1.82 G G = 0.001 G = 0.000 11549918 44338 10263938 C/T C = 0.635 C = 0.562 0.0293 0.74 C T = 0.365 T = 0.438 2569700 44499 10264099 T/G T = 0.006 T = 0.011 0.703 1.80 G G = 0.994 G = 0.989 2228615 44768 10264368 A/G A = 0.402 A = 0.484 0.0318 1.40 G G = 0.598 G = 0.516 ICAM-AA 45003 10264603 C/T C = 0.934 C = 0.958 0.309 1.59 T T = 0.066 T = 0.042 2569701 45341 10264941 G/A G = 1.000 G = 1.000 0.917 10.14 A A = 0.000 A = 0.000 2569702 45347 10264947 T/C T = 0.709 T = 0.646 0.0681 0.75 T C = 0.291 C = 0.354 2735440 45577 10265177 G/A G = 0.01 G = 0.006 0.624 0.52 G A = 0.990 A = 0.994 2569703 45627 10265227 C/G C = 0.563 C = 0.527 0.274 0.86 C G = 0.437 G = 0.473 10418913 45794 10265394 A/G A = 0.001 A = 0.002 0.923 2.09 G G = 0.999 G = 0.998 1056536 46244 10265844 C/T C = 1.000 C = 1.000 0.989 2.49 T T = 0.000 T = 0.000 2569704 46469 10266069 T/C T = 0.003 T = 0.001 0.905 0.24 T C = 0.997 C = 0.999 11673661 46999 10266599 G/C G = 0.997 G = 0.999 0.874 2.39 C C = 0.003 C = 0.001 10402760 47265 10266865 T/C T = 0.168 T = 0.104 0.0276 0.58 T C = 0.832 C = 0.896 ICAM-AB 47504 10267104 A/G A = 0.264 A = G = 0.736 G = 2569706 47547 10267147 G/A G = 0.997 G = 1.000 0.666 45.64 A A = 0.003 A = 0.000 2569707 47637 10267237 C/G C = 0.173 C = 0.171 0.942 0.99 C G = 0.827 G = 0.829 2436545 47691 10267291 C/A C = 0.001 C = 0.001 0.991 0.86 C A = 0.999 A = 0.999 2436546 47692 10267292 A/C A = 1.000 A = 0.998 0.866 0.26 A C = 0.000 C = 0.002 2916060 47788 10267388 A/C A = 0.99 A = 0.993 0.803 1.39 C C = 0.010 C = 0.007 2916059 47796 10267396 T/C T = 0.999 T = 0.999 0.968 0.73 T C = 0.001 C = 0.001 2916058 47800 10267400 T/A T = 1.000 T = 0.999 0.869 0.30 T A = 0.000 A = 0.001 2569708 47812 10267412 A/G A = 0.004 A = 0.003 0.936 0.73 A G = 0.996 G = 0.997 735747 47969 10267569 T/C T = 0.999 T = 1.000 0.91 2.15 C C = 0.001 C = 0.000 885743 48035 10267635 A/T A = 0.661 A = 0.676 0.698 1.07 T T = 0.339 T = 0.324 710845 48569 10268169 C/G C = 0.744 C = 0.665 0.0156 0.68 C G = 0.256 G = 0.335 2569709 48823 10268423 C/G C = 0.999 C = 1.000 0.967 1.45 G G = 0.001 G = 0.000 2569710 48838 10268438 A/G A = 0.999 A = 0.998 0.943 0.71 A G = 0.001 G = 0.002 2569711 48894 10268494 C/G C = 1.000 C = 1.000 0.98 0.60 C G = 0.000 G = 0.000 2569712 48934 10268534 A/T A = 1.000 A = 1.000 0.983 1.93 T T = 0.000 T = 0.000 12610026 49249 10268849 A/G A = 0.992 A = G G = 0.008 G = 4804129 49509 10269109 C/A C = 0.002 C = 0.002 0.978 0.83 C A = 0.998 A = 0.998 12150978 49718 10269318 A/G A = 0.8 A = 0.782 0.599 0.90 A G = 0.200 G = 0.218 439843 49963 10269563 C/A C = 1.000 C = 0.999 0.981 0.82 C A = 0.000 A = 0.001 892188 51193 10270793 T/C T = 0.487 T = 0.567 0.0122 1.38 C C = 0.513 C = 0.433 2291473 57181 10276781 T/C T = 0.913 T = 0.909 0.83 0.95 T C = 0.087 C = 0.091 281416 60184 10279784 A/G A = 0.456 A = 0.496 0.221 1.18 G G = 0.544 G = 0.504 281417 60530 10280130 T/C T = 0.532 T = 0.526 0.86 0.98 T C = 0.468 C = 0.474 882589 61354 10280954 T/C T = 0 T = 0.002 0.865 C C = 1.000 C = 0.998 1048941 62616 10282216 T/G T = 0.304 T = G = 0.696 G = 281418 62785 10282385 G/C G = 0.088 G = 0.0680 0.369 0.76 G C = 0.912 C = 0.932 430092 66351 10285951 C/T C = 0.764 C = 0.744 0.588 0.90 C T = 0.236 T = 0.256 368835 67386 10286986 A/G A = 0.303 A = 0.274 0.347 0.86 A G = 0.697 G = 0.726 2358583 67395 10286995 T/G T = 0.696 T = 0.674 0.505 0.90 T G = 0.304 G = 0.326 378395 67822 10287422 C/A C = 0.323 C = A A = 0.677 A = 395782 68028 10287628 T/C T = 0.726 T = 0.656 0.115 0.72 T C = 0.274 C = 0.344 1045384 68646 10288246 T/G T = 0.326 T = 0.302 0.424 0.89 T G = 0.674 G = 0.698 281427 70520 10290120 C/T C = 0.785 C = 0.823 0.226 1.27 T T = 0.215 T = 0.177 3745264 70966 10290566 T/G T = 0.156 T = 0.164 0.76 1.06 G G = 0.844 G = 0.836 281426 72451 10292051 G/A G = 0.437 G = 0.321 0.000196 0.61 G A = 0.563 A = 0.679 281425 73199 10292799 G/T G = 0.806 G = T = 0.194 T = 281424 74319 10293919 C/T C = 0.753 C = 0.748 0.861 0.97 C T = 0.247 T = 0.252 281423 76893 10296493 C/T C = 0.804 C = 0.804

0.993 1.00 T T = 0.196 T = 0.196 281422 77755 10297355 T/C T = 0.372 T = 0.364 0.829 0.97 T C = 0.628 C = 0.636 281420 79354 10298954 A/G A = 0.608 A = 0.567 0.213 0.85 A G = 0.392 G = 0.433 3745263 80901 10300501 A/G A = 0.064 A = 0.08 0.513 1.27 G G = 0.936 G = 0.920 3745262 80940 10300540 T/C T = 0.996 T = 0.999 0.731 4.38 C C = 0.004 C = 0.001 3745261 81111 10300711 T/C T = 0.987 T = 0.983 0.752 0.76 T C = 0.013 C = 0.017 3181049 82517 10302117 T/C T = 0.353 T = 0.363 0.761 1.04 C C = 0.647 C = 0.637 281412 82874 10302474 T/C T = 0.846 T = 0.841 0.823 0.96 T C = 0.154 C = 0.159 3181048 84978 10304578 A/G A = 1.000 A = 1.000 0.98 0.46 A G = 0.000 G = 0.000 2230399 86003 10305603 C/G C = 0.171 C = 0.161 0.708 0.93 C G = 0.829 G = 0.839 2278442 86226 10305826 G/A G = 0.42 G = 0.405 0.674 0.94 G A = 0.580 A = 0.595 3181047 87206 10306806 A/G A = 0.008 A = 0.003 0.654 0.30 A G = 0.992 G = 0.997 3181046 87535 10307135 T/C T = 0.999 T = 1.000 0.946 2.38 C C = 0.001 C = 0.000 2304237 87968 10307568 T/C T = 0.898 T = 0.907 0.726 1.10 C C = 0.102 C = 0.093 281413 88134 10307734 G/A G = 0.697 G = 0.702 0.877 1.03 A A = 0.303 A = 0.298 1058154 88297 10307897 A/C A = 0.22 A = 0.186 0.31 0.81 A C = 0.780 C = 0.814 3176769 88434 10308034

T/C T = 0.801 T = 0.786 0.593 0.91 T C = 0.199 C = 0.214 2304238 90602 10310202 G/A G = 0.002 G = 0.001 0.954 0.62 G A = 0.998 A = 0.999 2304239 90750 10310350 T/C T = 0.001 T = 0.003 0.876 2.50 C C = 0.999 C = 0.997 2304240 90792 10310392 G/A G = 0.828 G = 0.797 0.261 0.82 G A = 0.172 A = 0.203 3176768 91065 10310665 A/G A = 0.355 A = 0.35 0.871 0.98 A G = 0.645 G = 0.650 3176767 91151 10310751 C/A C = 0.278 C = 0.277 0.951 0.99 C A = 0.722 A = 0.723 3176766 91178 10310778 C/T C = 0.768 C = 0.765 0.937 0.99 C T = 0.232 T = 0.235 281414 91685 10311285 G/A G = 0.697 G = 0.72 0.47 1.12 A A = 0.303 A = 0.280 281415 92393 10311993 T/G T = 0.341 T = 0.312 0.343 0.88 T G = 0.659 G = 0.688

[0295] FIG. 1A shows proximal SNPs in and around the ICAM region for females. The position of each SNP on the chromosome is presented on the x-axis. The y-axis gives the negative logarithm (base 10) of the p-value comparing the estimated allele in the case group to that of the control group. The minor allele frequency of the control group for each SNP designated by an X or other symbol on the graphs FIG. 1A can be determined by consulting Table 12. By proceeding down the Table from top to bottom and across the graphs from left to right the allele frequency associated with each symbol shown can be determined.

[0296] To aid the interpretation, multiple lines have been added to the graph. The broken horizontal lines are drawn at two common significance levels, 0.05 and 0.01. The vertical broken lines are drawn every 20 kb to assist in the interpretation of distances between SNPs. Two other lines are drawn to expose linear trends in the association of SNPs to the disease. The light gray line (or generally bottom-most curve) is a nonlinear smoother through the data points on the graph using a local polynomial regression method (W. S. Cleveland, E. Grosse and W. M. Shyu (1992) Local regression models. Chapter 8 of Statistical Models in S eds J. M. Chambers and T. J. Hastie, Wadsworth & Brooks/Cole.). The black line provides a local test for excess statistical significance to identify regions of association. This was created by use of a 10 kb sliding window with 1 kb step sizes. Within each window, a chi-square goodness of fit test was applied to compare the proportion of SNPs that were significant at a test wise level of 0.01, to the proportion that would be expected by chance alone (0.05 for the methods used here). Resulting p-values that were less than 10.sup.-8 were truncated at that value.

[0297] Finally, the gene or genes present in the loci region of the proximal SNPs as annotated by Locus Link (http address: www.ncbi.nlm.nih.gov/LocusLink/) are provided on the graph. The exons and introns of the genes in the covered region are plotted below each graph at the appropriate chromosomal positions. The gene boundary is indicated by the broken horizontal line. The exon positions are shown as thick, unbroken bars. An arrow is place at the 3' end of each gene to show the direction of transcription.

[0298] Additional Genotyping

[0299] In addition to the ICAM region incident SNP, fourteen other SNPs were genotyped in the discovery cohort. The discovery cohort is described in Example 1. The SNP rs2228615 is located in the ICAM5 encoding portion of the sequence, and is associated with breast cancer with a p-value of 0. .00236, and encoded non-synonymous amino acids (see Table 15).

[0300] The methods used to verify and genotype the two proximal SNPs of Table 15 are the same methods described in Examples 1 and 2 herein. The PCR primers and extend primers used in these assays are provided in Table 13 and Table 14, respectively.

18TABLE 13 dbSNP rs# Forward PCR primer Reverse PCR primer 1801714 ACGTTGGATGAGGGTTGCAGAGCAGGAGAA ACGTTGGATGAGCCAAGGTGACGCTGAATG 2228615 ACGTTGGATGAGATGGTGACAGTAACCTGC ACGTTGGATGTGGCATTTAGCTGAAGCTGG 2569703 ACGTTGGATGATAACCCTTGGACGCCGATC ACGTTGGATGTTAGACGAAAAAGGCGCCAC 1799969 ACGTTGGATGAACCTCTGGTCCCCCAGTGC ACGTTGGATGTCCTAGAGGTGGACACGCAG 1059849 ACGTTGGATGAAGCTGAGGCCACAGGGAG ACGTTGGATGAGAGGGAATGGATGCAGAAG 3093035 ACGTTGGATGTAGAAAGCAGTGCGATCTGG ACGTTGGATGGGAGACATAGCGAGATTCTG 281439 ACGTTGGATGGCTCGCTGGCACTTTCGTC ACGTTGGATGGAGCCATACCTCTAAGCACC 281432 ACGTTGGATGAGCTGGGACTTTCCTTCTTG ACGTTGGATGGCCTTCAGCTATCTAATCCC 901886 ACGTTGGATGTACGCGATCTGGTCGCTCTG ACGTTGGATGTTCAGGCCCCACCTTCTGTT 5030382 ACGTTGGATGACTCACAGAGCACATTCACG ACGTTGGATGAGATCTTGAGGGCACCTACC 2569693 ACGTTGGATGGTGTCTACTCAGCGTGTGTG ACGTTGGATGCTTGTTCTCGCGTGGATGTC 2569702 ACGTTGGATGACCCTCCAGACCTTGAACCA ACGTTGGATGGTCAAGGACGTAACGCTAAC 3093030 ACGTTGGATGACTTCCTCCCCCAAGAAAAC ACGTTGGATGAGAGACCCAGAAGGTCATAG 2075741 ACGTTGGATGAGACCCAGTGTCTCTCCTGT ACGTTGGATGAAGATGCCAGTCCGTGGACC 11549918 ACGTTGGATGTAGATGGTCACGTTCTCCCG ACGTTGGATGACAGCTAGCGCAGAGCAGG- A

[0301]

19TABLE 14 dbSNP rs# Extend Primer Term Mix 1801714 CCTTCAGCAGGAGCTGGGCCCTC ACT 2228615 TAACCTGCGCAGCTGGG ACT 2569703 GAGGTGTCACGCTAGTCGAG ACT 1799969 CTCCGAGACTGGGAACAGCC ACG 1059849 AGGGGCGACTCCACGGA ACT 3093035 CTGAGTCCGGATCAGAA ACG 281439 GTCCCGCCCCCTCCGTCGCGTGC ACT 281432 GGAGTCATGGAGGGTTT ACT 901886 TCCGCAGCTCTTTGAAC ACT 5030382 CACATTCACGGTCACCT ACG 2569693 CCTTCTGCTCGGTGGGTGG ACT 2569702 ACCTTGAACCAGATAGAA ACT 3093030 AAACATTGTGGGTTGATGG ACG 2075741 CCCGGGTACCTCCTTACGCT ACT 11549918 CCCCAGGGTGACGTTGCAGA ACG

[0302] Table 15, below, shows the case and control allele frequencies along with the p-values for the SNPs genotyped. The disease associated allele of column 4 is in bold and the disease associated amino acid of column 5 is also in bold. The chromosome positions provided correspond to NCBI's Build 34.

20TABLE 15 Genotyping Results Breast Position in Amino Cancer SEQ ID Chromosome Alleles Acid AF F Odds Associated dbSNP rs# NO: 1 Position (A1/A2) Change AF F case control p-value Ratio Allele 1801714 36608 10240417 T/C L352P T = 0.010 T = 0.030 0.0734 2.26 C C = 0.990 C = 0.097 2228615 44768 10248577 A/G T348A A = 0.340 A = 0.430 0.00236 1.47 G G = 0.660 G = 0.570 2569703 45627 10265227 G/C G = 0.508 G = 0.581 0.019 1.34 C C = 0.492 C = 0.419 1799969 36192 10255792 G/A G241R G = 0.912 G = 0.883 0.12 0.723 G A = 0.088 A = 0.117 1059849 12054 10231654 A/G A = 0.443 A = 0.364 0.00996 0.719 A G = 0.557 G = 0.636 3093035 24373 10243973 G/A G = 0.941 G = 0.951 0.466 1.22 A A = 0.059 A = 0.049 281439 41510 10261110 C/G C = 0.765 C = 0.781 0.563 1.09 G G = 0.235 G = 0.219 281432 32058 10251658 C/G C = 0.549 C = 0.554 0.876 1.02 G G = 0.451 G = 0.446 901886 43531 10263131 T/C T = 0.557 T = 0.483 0.0177 0.741 T C = 0.443 C = 0.517 5030382 37083 10256683 G/A G = 0.616 G = 0.536 0.0102 0.721 G A = 0.384 A = 0.464 2569693 41304 10260904 T/C T = 0.35 T = 0.451 0.0012 1.53 C C = 0.65 C = 0.549 2569702 45347 10264947 T/C T = 0.667 T = 0.562 0.000829 0.643 T C = 0.333 C = 0.438 3093030 38803 10258403 C/T C = 0.613 C = 0.541 0.0235 0.745 C T = 0.387 T = 0.459 2075741 42498 10262098 C/G C = 0.392 C = 0.466 0.0168 1.35 G G = 0.608 G = 0.534 11549918 44338 10263938 G/A G = 0.663 G = 0.558 0.000613 0.642 G A = 0.337 A = 0.442

Example 5

MAPK10 Proximal SNPs

[0303] It has been discovered that a polymorphic variation (rs1541998) in a region that encodes MAPK10 is associated with the occurrence of breast cancer (see Examples 1 and 2). Subsequently, SNPs proximal to the incident SNP (rs1541998) were identified and allelotyped in breast cancer sample sets and control sample sets as described in Examples 1 and 2. Approximately ninety-two allelic variants located within the MAPK10 region were identified and allelotyped. The polymorphic variants are set forth in Table 16. The chromosome position provided in column four of Table 16 is based on Genome "Build 34" of NCBI's GenBank.

21TABLE 16 Position in SEQ ID Chromosome Allele Genome Deduced dbSNP rs# NO: 2 Chromosome Position Variants Letter Iupac 2575681 206 4 87372306 c/t g R 2575680 1505 4 87373605 a/g t Y 2589505 3796 4 87375896 c/t a R 2589504 3950 4 87376050 g/a t Y 2164538 4527 4 87376627 t/c a R 2575679 7588 4 87379688 a/g t Y 10305 8482 4 87380582 a/t a W 2869408 9016 4 87381116 c/g g S 2904086 9018 4 87381118 c/t t Y 934648 9747 4 87381847 t/c g R 2589511 12207 4 87384307 g/a g R 2060589 13040 4 87385140 g/a t Y 2164537 13492 4 87385592 t/c g R 2575678 13802 4 87385902 a/c t K 2575677 13918 4 87386018 g/c g S 2589510 14153 4 87386253 a/g c Y 2589509 14370 4 87386470 t/g c M 2164536 15068 4 87387168 a/c t K 2164535 15474 4 87387574 t/a a W 1946734 17117 4 87389217 c/g c S 2589525 17777 4 87389877 g/a g R 2589523 19497 4 87391597 c/t a R 3755970 19646 4 87391746 a/c a M MAPK10-AA 21751 4 87393851 a/c g K 2575675 22185 4 87394285 g/a t Y 1202 22703 4 87394803 t/c c Y 1201 22763 4 87394863 a/g a R 2589516 23391 4 87395491 g/t a M 2575674 23841 4 87395941 a/t a W 2589515 23883 4 87395983 g/c g S 3733367 24132 4 87396232 c/t c Y 958 24169 4 87396269 c/t c Y 2589506 25987 4 87398087 g/a t Y 1436524 26072 4 87398172 a/g c Y 2575672 26376 4 87398476 c/t g R 2589518 26614 4 87398714 g/a c Y 3775164 26727 4 87398827 t/g t K 2589514 26827 4 87398927 g/a c Y 3775166 27084 4 87399184 t/c t Y MAPK10-AB 30965 4 87403065 g/a c Y 3775167 32436 4 87404536 c/t c Y 3822035 32821 4 87404921 t/a t W 3775168 32979 4 87405079 a/t t W 3775169 33572 4 87405672 t/c t Y 2043650 35142 4 87407242 a/g c Y 2043649 35237 4 87407337 t/g c M 3775170 36014 4 87408114 t/a t W 1541998 36439 4 87408539 c/t a R MAPK10-AC 36838 4 87408938 g/a a R MAPK10-AD 36889 4 87408989 g/a g R MAPK10-AE 38639 4 87410739 t/c t Y 2282599 38657 4 87410757 t/g a M MAPK10-AF 38865 4 87410965 t/c t Y MAPK10-AG 38885 4 87410985 a/g g R MAPK10-AH 38943 4 87411043 t/c t Y MAPK10-AI 39035 4 87411135 t/c c Y MAPK10-AJ 39046 4 87411146 t/c t Y 2282598 39218 4 87411318 c/t g R 2282597 39241 4 87411341 g/a t Y 3775171 40105 4 87412205 a/c a M 3775172 40240 4 87412340 c/t t Y 3775173 41162 4 87413262 t/c t Y 3775174 42477 4 87414577 a/c a M 1469870 46191 4 87418291 g/c c S 1436522 50467 4 87422567 t/c a R 1946733 52934 4 87425034 g/a c Y 983362 54730 4 87426830 t/c c Y 3755971 58283 4 87430383 c/t t Y 3822036 58378 4 87430478 c/g g S 3775175 59505 4 87431605 g/a a R 1436525 60229 4 87432329 g/a g R 3822037 61108 4 87433208 c/g c S 3775176 62587 4 87434687 g/a a R 993593 63133 4 87435233 c/t c Y 1436527 63616 4 87435716 c/t c Y 1436529 65377 4 87437477 t/c c Y 3775180 65442 4 87437542 a/c a M 3775181 65548 4 87437648 t/g g K 3775182 65878 4 87437978 t/g g K 3775183 66222 4 87438322 g/a a R 3775184 66354 4 87438454 a/g a R 733245 67224 4 87439324 a/t a W 3775185 68198 4 87440298 t/g g K 1561154 68729 4 87440829 t/c c Y 3775186 69058 4 87441158 a/c c M 3775187 69527 4 87441627 t/c t Y 1010778 70774 4 87442874 a/g t Y 2282596 71232 4 87443332 t/a t W 2282595 71943 4 87444043 a/c t K 2118044 73397 4 87445497 a/t a W 1469869 76322 4 87448422 c/t c Y MAPK10-AK 110704 4 87482804 a/g t Y

[0304] Assay for Verifing and Allelotyping SNPs

[0305] The methods used to verify and allelotype the proximal SNPs of Table 16 are the same methods described in Examples 1 and 2 herein. The PCR primers and extend primers used in these assays are provided in Table 17 and Table 18, respectively.

22TABLE 17 dbSNP rs# Forward PCR primer Reverse PCR primer 2575681 ACGTTGGATGTTATATAGCCTTCTTTTCTC ACGTTGGATGTTCACTGCTAACATGCATGG 2575680 ACGTTGGATGGAGCCCAATACAATCAGGTG ACGTTGGATGGCCCTGAAGTTTTTGAATGG 2589505 ACGTTGGATGCATTTTATGAGAAGATGCAC ACGTTGGATGAGACTGTAGCCTAAATGAGG 2589504 ACGTTGGATGCTGTGTGATTTGGACAACCC ACGTTGGATGGGATAGGAAACATATTAAGG 2164538 ACGTTGGATGAGAGGTCATCTTAATGGGCC ACGTTGGATGTACTGCAGAGCTCTCCCTTG 2575679 ACGTTGGATGTAAGCCAGTAACACATGCCG ACGTTGGATGCTTTCCTGCTGCATTTAGTG 10305 ACGTTGGATGGGTGAAGCTTGAAAGCAAGC ACGTTGGATGTTCAAGAATTATTTTATTGC AAGTC 2869408 ACGTTGGATGGCTTTGAATTACTCTGTCCC ACGTTGGATGTCCCAGTACCTAAGTAGCAG 2904086 ACGTTGGATGGCTTTGAATTACTCTGTCCC ACGTTGGATGTCCCAGTACCTAAGTAGCAG 934648 ACGTTGGATGTGTACTGCTTTCATCCTTGC ACGTTGGATGACTGGTTGATACCATAGGAC 2589511 ACGTTGGATGGTAGAGCTGACATCATAGGC ACGTTGGATGCCTACTGTGTTAGCCTCACT 2060589 ACGTTGGATGACAACTACGTGTAACTGTCC ACGTTGGATGCCAATACCTTTAACACCCAA- C 2164537 ACGTTGGATGAACACACTTAGTACCCACGC ACGTTGGATGCAAGGCAAAATGTTTCCAGC 2575678 ACGTTGGATGAAGCACCATTTGTGGCTCAG ACGTTGGATGCTTCAAGAGGCCATACAGAC 2575677 ACGTTGGATGGAAGGATAAGCCACAGTGAG ACGTTGGATGGATGCCAATTTGGTTTGCCC 2589510 ACGTTGGATGAATGGCATGGGAACTTGGAC ACGTTGGATGTGCACCACACTGAAGTGATC 2589509 ACGTTGGATGATACGCAGGTTGTAGAGAGG ACGTTGGATGTGAATCATGGTTGCCTCCTG 2164536 ACGTTGGATGCTGGAGAACAAAAGACCACC ACGTTGGATGGTGATGAAAACCATGTGAGC 2164535 ACGTTGGATGGAATGATGTAAACGTTGGAG ACGTTGGATGACCAGCACTATTACCCATGC 1946734 ACGTTGGATGGTCAGCAAATCTGCCTTCAC ACGTTGGATGAACCTGCTTTGTGGTCTTCG 2589525 ACGTTGGATGGTATTTAAATTAGTGGTGTG ACGTTGGATGAAGAACATTGAAAGAAGCAG 2589523 ACGTTGGATGAGCAGGGTTAAATTTCCCAG ACGTTGGATGTCATGTAGCTAAACAAAGGC 3755970 ACGTTGGATGGTGACCATGTAGAAATCTGTG ACGTTGGATGTACAACTAGTATCTACAGAC MAPK10-AA ACGTTGGATGCTTGGGAAATAACAGGTGAC ACGTTGGATGCACTTGTCTGTCTTAAC- ACAC 2575675 ACGTTGGATGTTGGGAAGGTACTAACAGCG ACGTTGGATGTCGTACCTGCATAAGTGGTG 1202 ACGTTGGATGTCAAGCAATAGAGACCACAG ACGTTGGATGTAATCTCAGAATGGCAGCAC 1201 ACGTTGGATGCCTGTGGTCTCTATTGCTTG ACGTTGGATGTGCCAGTGCTCTGAAAACTG 2589516 ACGTTGGATGACTCACACTGTGGTTTGGGG ACGTTGGATGCATACTCTGCCAAAGTTTTA 2575674 ACGTTGGATGCTCTCCTACTCTTTACTGTC ACGTTGGATGGTGGGTAACAGTTTTCAGGC 2589515 ACGTTGGATGGCCAAACCATTTTGTGCCTG ACGTTGGATGCACCTGTATACCAATTTGTA- G 3733367 ACGTTGGATGCAGATGGGTTTATGTCAGAG ACGTTGGATGGGCTCTACCAAGACATAATG 958 ACGTTGGATGCCCAGTGCATTATGTCTTGG ACGTTGGATGATCCGCATGTGTCTGTATTC 2589506 ACGTTGGATGTGTTATGCGGGAGTATAAGG ACGTTGGATGGCAACTCAGCTAGCCTTTAC 1436524 ACGTTGGATGATTGTTTCCAGGGTGCTCTG ACGTTGGATGGAGTTGCCAGTAGCTTTGAG 2575672 ACGTTGGATGCTCCAGGAGCAAGGATTATG ACGTTGGATGATAGTGTTATCACATAGACC 2589518 ACGTTGGATGAATGATATGCACCGATCTTC ACGTTGGATGCCAGGCAAAAAGAATGACCG 3775164 ACGTTGGATGAAGTTTCCCTGGTCGTGATC ACGTTGGATGGAACATGAAAAATTCATAAGC 2589514 ACGTTGGATGCTTAAATGTCTCTAGAAAAGG ACGTTGGATGTATACATTGTCCTGATAGAG 3775166 ACGTTGGATGCTGAGGAGTCCATCATAGTG ACGTTGGATGCTGTTTTTCACCCCCGATT- C MAPK10-AB ACGTTGGATGGATAAGTATTGGCTTAATCTG ACGTTGGATGTTTCATTGCTCATGGATTAG 3775167 ACGTTGGATGGCTTCTGATTTTATATGGCAC ACGTTGGATGGAAACAAGCAGATGTCATGG 3822035 ACGTTGGATGATAAATGCCTCCTTGCCTGC ACGTTGGATGGAACTCCTGTTTATTGCCT- AC 3775168 ACGTTGGATGTCTCACATTGACTGGACAAC ACGTTGGATGCCAAGCAGTTTGCGAAAATC 3775169 ACGTTGGATGATGCTGAACAACAGGATGGG ACGTTGGATGGGGAGAGAATGGTTGCATAT 2043650 ACGTTGGATGCTGTGCCTTGCACATAGTAG ACGTTGGATGGCTGAGGGAGAAATTGAGTG 2043649 ACGTTGGATGGTCCTACTAGTCCCTGTATG ACGTTGGATGGCACTACATGGGACACAAAG 3775170 ACGTTGGATGCCCATTTTTGCTAGCAGGAG ACGTTGGATGCCTAAGACCTATGCTCTCAC 1541998 ACGTTGGATGCTGATTATTCTGATGGTAATG ACGTTGGATGGCCCATGTTAACATTTTCT- TC MAPK10-AC ACGTTGGATGCTCTCTGCTAATTACAAGGC ACGTTGGATGTACGTTTTGATGGGGTTGAG MAPK10-AD ACGTTGGATGAGATACCTATTTGTGCCAGG ACGTTGGATGTACGTTTTGATGGGGTTGAG MAPK10-AE ACGTTGGATGTGTCTTTTCATGCCGAAAGC ACGTTGGATGCGACAAACACTGACAATC- AG 2282599 ACGTTGGATGGACTGCTATTCTCTTAGACC ACGTTGGATGCATTCTTGAGCAAATGTGAC MAPK10-AF ACGTTGGATGGTCATATATCTGAGGTGGAG ACGTTGGATGCAAGGTATTCTCGTGCATTG MAPK10-AG ACGTTGGATGGTCATATATCTGAGGTGGAG ACGTTGGATGCAAGGTATTCTCGTGCAT- TG MAPK10-AH ACGTTGGATGCGAAATAAATGAGGGCAAGG ACGTTGGATGGGAGGCTGCCGAATAAAAAC MAPK10-AI ACGTTGGATGTGGGTCAGCAGCAAATATTG ACGTTGGATGTGCCCTCATTTATTTCGGTG MAPK10-AJ ACGTTGGATGTGGGTCAGCAGCAAATATTG ACGTTGGATGTGCCCTCATTTATTTCGG- TG 2282598 ACGTTGGATGGTGAATGAAGGAAAAGTAGC ACGTTGGATGCACGCCTAAGCAATTAATGAC 2282597 ACGTTGGATGACACTTGATTACAATGGCCC ACGTTGGATGGCATGGTTCTGTTATAAGGC 3775171 ACGTTGGATGCTGTCATGATTCAAGCTACC ACGTTGGATGTTTGGCTCATGAACAGCACC 3775172 ACGTTGGATGCTGCAAAGTATCTGGCTATG ACGTTGGATGGCTCCGTGAGTAGTTATTTC 3775173 ACGTTGGATGTAAATTTGCAGAGGCCGTCG ACGTTGGATGCAAGAGGGCTGCTTTAAACC 3775174 ACGTTGGATGCATCCTTGATCCACCCTTTG ACGTTGGATGCATGTCGTCAGAAGTGACAA 1469870 ACGTTGGATGATGGCACAGTTTAGCATGTC ACGTTGGATGATACTGAGCTCCATTTTGGG 1436522 ACGTTGGATGATTGGAAGGAGGAAGCATAG ACGTTGGATGGGAATTGAAATTGGCATTGC 1946733 ACGTTGGATGTAGCTTCTAAACATCTCTTG ACGTTGGATGGCAGGAGGATAGATCTGTAG 983362 ACGTTGGATGCACATTGCTCCCTCCTTTAC ACGTTGGATGGCGGCCGAAGAGTACTATTT 3755971 ACGTTGGATGGTGGTAACAGATTGCTGTAC ACGTTGGATGGCGTAAAGAACTTTTGGTGAC 3822036 ACGTTGGATGCAACACATACCTTAGGTAAGA ACGTTGGATGCTGAATTCCTTCGATGTT- CC 3775175 ACGTTGGATGCATTATAAAAACAGTTTCTTG ACGTTGGATGGAGTAGACAGTGGCTATTAA 1436525 ACGTTGGATGGCTTACACTAGCTACTTGGG ACGTTGGATGGTGCAATCTTGGTTCACTGC 3822037 ACGTTGGATGTCCCACCCTGACTTCTTTGC ACGTTGGATGGTAATCCATAAACTGTGGGA- G 3775176 ACGTTGGATGTAGTCCAAGTATTTCCCAAG ACGTTGGATGAAAAGGTCACCAGTGACCTG 993593 ACGTTGGATGTAGGCACTGCAGATCTTTTC ACGTTGGATGCACTAAAATAATAAGAAAGC TC 1436527 ACGTTGGATGCTGTATAGAGAGCTGTTTGC ACGTTGGATGAGCACTGTGAGTTAAACCTG 1436529 ACGTTGGATGAATGTTGGACCACATGTACG ACGTTGGATGCTATGGCAGCAGAAGAGTAG 3775180 ACGTTGGATGTCCACTGAATGTGCACTTCC ACGTTGGATGCAAGACTGTAGCCCTACAAC 3775181 ACGTTGGATGCTTCTGCCAAGACTATCAGG ACGTTGGATGGTAAGCATCCCCCTAATAAT 3775182 ACGTTGGATGGCTGGACTCTATTAGGCCAT ACGTTGGATGGATATCTCCCTCCTATTGGC 3775183 ACGTTGGATGTGCAGATATGTAGGCCAAGC ACGTTGGATGGATCTCTGATCTTAGACCAC 3775184 ACGTTGGATGGTTCTACTTTGACCACAGGC ACGTTGGATGGACCAGCAACCATGATGAAG 733245 ACGTTGGATGTAGTCTAGTGGAGGATGTCG ACGTTGGATGCCAGCTATAATGTAGACCAC 3775185 ACGTTGGATGTGTGGAATCTATAATGTGTC ACGTTGGATGACCTACCTCTTCTTTGCCAG 1561154 ACGTTGGATGAATAGAAGATGCTCTAACTC ACGTTGGATGGAAGATGCAAATAAGTCAACC 3775186 ACGTTGGATGGATATGCTATGTGTGCTAAG ACGTTGGATGTTGTACTTTGGTAGTTTGGG 3775187 ACGTTGGATGAATCATGATCCCAGGGCAAG ACGTTGGATGTAGCACCTTCAGGATCTTTC 1010778 ACGTTGGATGGGATTTGTTCTTAATCTTTC ACGTTGGATGCAGAGGAAAGAAAACTGAAAG 2282596 ACGTTGGATGGGTGGCTTTGTGAAACCTTG ACGTTGGATGTCATACTGATCAACCTGAAG 2282595 ACGTTGGATGAAGGAAATTTGTCAGAGAGG ACGTTGGATGCTTTTCCATCACATCAAGGG 2118044 ACGTTGGATGGTCATTGCCTCTAGCTAGTG ACGTTGGATGAACAACTTGGCTAATTCTAC 1469869 ACGTTGGATGTTCGATATATCAGAGCCTTG ACGTTGGATGCATGGCGAGGAAATCTGTTT MAPK10-AK ACGTTGGATGTTTCTCTCGTTTCCTCTGTC ACGTTGGATGACTTACACATCTTGGAAC- TC

[0306]

23TABLE 18 dbSNP rs# Extend Primer Term Mix 257568 TTTCTTTTCTCTTTTAGGAATCT ACG 2575680 GGATGCATGGTTTCTCTAAT ACT 2589505 GTTTTAGCATAATTGCTTCTTTA ACG 2589504 GTGCTAGGATCCTCAGT ACG 2164538 GTCACATTCTTACCCTC ACT 2575679 CTTCCTGGACATTAAATTGT ACT 10305 AGCTAAATTGCAACAACA ACG 2869408 CGAATCTCTTTAACTGCTG ACT 2904086 GAATCTCTTTAACTGCTGGA ACG 934648 ACTCTCCCACTGAGCAAGC ACT 2589511 CTCCAAAGGATACCCAGA ACG 2060589 ACTCTATCCATGTCTACAC ACG 2164537 CGGCTTCTACTCTCTTATTCA ACT 2575678 TGTGGCTCAGGTCCAGG ACT 2575677 GGAATGAGGGCAACAGGA ACT 2589510 TTTGGCAACAGGTAACCAGC ACT 2589509 AGGGCTGCAGGGAAGAT ACT 2164536 CCTGTGTTCCTTTGTATTTATAT ACT 2164535 GATAAATGTGAGATTGAGAGA CGT 1946734 GCATTCTAGTGGAGAAGTCA ACT 2589525 TTAGTGGTGTGACTTGCA ACG 2589523 TTTCCCAGATTAATTATCAGATT ACG 3755970 GGTTTCTTCTAAAACTGACCT ACT MAPK10-AA GGTGACTATTTAAGAAATATTTGG ACT 2575675 GTTCTTGCCTGGTTTAC ACG 1202 CCACCTGCACCATCGCCAT ACT 1201 TTCTATTGCTTGAAGAGAGAAAG ACT 2589516 GGTTTGGGGGTTTCATT CGT 2575674 TATTCACACCTGCCTTC CGT 2589515 GAAAACTGTTACCCACTC ACT 3733367 GTAATAGATCACATGAAATGGAC ACG 958 TTATGTCTTGGTAGAGCC ACG 2589506 GAGAAGAAACCTGCCCA ACG 1436524 CCAGGGTGCTCTGGTTTAATT ACT 2575672 CAAGGATTATGTTAACCACT ACG 2589518 TGCACCGATCTTCAAATAAA ACG 3775164 TTTTTTGGGATCTTGATATTTTTA ACT 2589514 AGAAAAGGTTTTTAAAGTCCTC ACG 3775166 AACTTATGAAAGAATATGAAGGAT ACT MAPK10-AB ATTGGCTTAATCTGTACATCAATT ACG 3775167 TAAGAGAAGTCTTCAGTGCTT ACG 3822035 CTGGATGATCCATTCAAG CGT 3775168 ACTGGACAACTGAACAC CGT 3775169 GCAGAGATTTTTCAAAATCTCTAA ACT 2043650 GCACATAGTAGTAGCTCA ACT 2043649 CCTCTTGTCTTATTATCCC ACT 3775170 TTTTTAAAGCTGAAAATAAACCA CGT 1541998 ATTATTCTGATGGTAATGATCCAG ACG MAPK10-AC TAGAGCAGTAAAGGAATCTCAA ACG MAPK10-AD TATTTGTGCCAGGCTCTCTG ACG MAPK10-AE CATGCCGAAAGCAATGTCAC ACT 2282599 CTAAAACTTCATCTGTCTTTTCA ACT MAPK10-AF TCTGAGGTGGAGGCTGCC ACT MAPK10-AG TCTGAGGTGGAGGCTGCC ACT MAPK10-AH GGGCAAGGTATTCTCGTGC ACT MAPK10-AI AATGAATCCTCCATAAGTTTACA ACT MAPK10-AJ TTGCAATATGAATGAATCCTCC ACT 2282598 AGGAAAAGTAGCTTCTGGG ACG 2282597 CAGAAGCTACTTTTCCTTCA ACG 3775171 GAATTAGAGAAGGGTCACT ACT 3775172 TATGAAAATAGAAGACTTTGCC ACG 3775173 GCCGTCGAACAAATACT ACT 3775174 GCTTCTCTAAGTACAGCTC ACT 1469870 CTTATATTCTCTGTGGCACCAA ACT 1436522 GAGGAAGCATAGATTTGGTGT ACT 1946733 CTAAACATCTCTTGAATATTCTG ACG 983362 GCTCAAATGTTACCTTCTCAAA ACT 3755971 AACAGCATTCTGGCATATA ACG 3822036 CAGAAAAAGTGCTTGAGG ACT 3775175 CAGTTTCTTGTGGTCCC ACG 1436525 GGCTTAAACCTGGGAGG ACG 3822037 TTTGCTTATTTCATAGAAGGAAT ACT 3775176 TATTTCCCAAGTGCCCA ACG 993593 AGCAACAGAGGCTTTTTCTA ACG 1436527 GAGCTGTTTGCATTTATAACTCA ACG 1436529 ACCACATGTACGTAAGGGGA ACT 3775180 TATGTGTTGATGTCACTCTT ACT 3775181 GGTTGGTATAGTACTTGCGAT ACT 3775182 CTGTCAGTTGCCTTAGG ACT 3775183 AGTCAAGACCAGCTGGG ACG 3775184 CTCTTTCTTCTGATCCC ACT 733245 CCTTAGATTCCCAAACAAAAC CGT 3775185 TTTGGTTTAAACTAATGACACTA ACT 1561154 AGATGCTCTAACTCTGGTTCA ACT 3775186 GCTAAGCTAUAGTTATACTACGA ACT 3775187 AGTGCATTACAGTGGTC ACT 1010778 TTGAAATACTGTTTGTTTCCCCAA ACT 2282596 GAAACCTTGCATGAACT CGT 2282595 AAGTATGGAATAGTATCTTCCT ACT 2118044 GTGGGGTTAGATATTATTTCCTGA CGT 1469869 AAACACCATCTACTCTGAAGAA ACG MAPK10-AK CGTTTCCTCTGTCCCTTCC ACT

[0307] Genetic Analysis of Allelotyping Results

[0308] Allelotyping results are shown for cases and controls in Table 19. The allele frequency for the A2 allele is noted in the fifth and sixth columns for breast cancer pools and control pools, respectively, where "AF" is allele frequency. SNPs with blank allele frequencies were untyped.

24TABLE 19 Position in Breast Cancer SEQ ID Chromosome A1/A2 Associated dbSNP rs# NO: 2 Position Allele Case AF Control AF p-Value OR Allele 2575681 206 87372306 C/T C = 0.610 C = 0.631 0.499 1.09 T T = 0.390 T = 0.369 2575680 1505 87373605 A/G A = 0.404 A = 0.411 0.84 1.03 G G = 0.596 G = 0.589 2589505 3796 87375896 C/T C = 0.515 C = 0.500 0.655 0.94 C T = 0.485 T = 0.500 2589504 3950 87376050 G/A G = 0.744 G = 0.725 0.506 0.91 G A = 0.256 A = 0.275 2164538 4527 87376627 T/C T = 0.595 T = 0.586 0.775 0.96 T C = 0.405 C = 0.414 2575679 7588 87379688 A/G A = 0.968 A = 0.988 0.185 2.68 G G = 0.032 G = 0.012 10305 8482 87380582 A/T A = 0.303 A = T = 0.697 T = 2869408 9016 87381116 C/G C = 0.292 C = 0.287 0.879 0.98 C G = 0.708 G = 0.713 2904086 9018 87381118 C/T C = 0.003 C = 0.002 0.822 0.40 C T = 0.997 T = 0.998 934648 9747 87381847 T/C T = 0.345 T = 0.337 0.786 0.96 T C = 0.655 C = 0.663 2589511 12207 87384307 G/A G = 0.599 G = A = 0.401 A = 2060589 13040 87385140 G/A G = 0.001 G = 0.008 0.431 13.10 A A = 0.999 A = 0.992 2164537 13492 87385592 T/C T = 0.737 T = 0.695 0.197 0.81 T C = 0.263 C = 0.305 2575678 13802 87385902 A/C A = 0.886 A = 0.928 0.181 1.66 C C = 0.114 C = 0.072 2575677 13918 87386018 G/C G = 0.080 G = 0.027 0.00252 0.32 G C = 0.920 C = 0.973 2589510 14153 87386253 A/G A = 0.592 A = 0.582 0.767 0.96 A G = 0.408 G = 0.418 2589509 14370 87386470 T/G T = 0.799 T = 0.785 0.599 0.92 T G = 0.201 G = 0.215 2164536 15068 87387168 A/C A = 0.378 A = 0.398 0.509 1.09 C C = 0.622 C = 0.602 2164535 15474 87387574 T/A T = 0.430 T = 0.426 0.891 0.98 T A = 0.570 A = 0.574 1946734 17117 87389217 C/G C = 0.003 C = 0.001 0.782 0.22 C G = 0.997 G = 0.999 2589525 17777 87389877 G/A G = 0.607 G = 0.606 0.983 1.00 G A = 0.393 A = 0.394 2589523 19497 87391597 C/T C = 0.225 C = 0.186 0.139 0.79 C T = 0.775 T = 0.814 3755970 19646 87391746 A/C A = 0.880 A = 0.894 0.525 1.15 C C = 0.120 C = 0.106 MAPK10-AA 21751 87393851 A/C A = 0.014 A = C = 0.986 C = 2575675 22185 87394285 G/A G = 0.347 G = 0.305 0.154 0.83 G A = 0.653 A = 0.695 1202 22703 87394803 T/C T = 0.238 T = 0.241 0.909 1.02 C C = 0.762 C = 0.759 1201 22763 87394863 A/G A = 0.872 A = 0.883 0.611 1.11 G G = 0.128 G = 0.117 2589516 23391 87395491 G/T G = 0.575 G = 0.519 0.0708 0.80 G T = 0.425 T = 0.481 2575674 23841 87395941 A/T A = 0.419 A = 0.340 0.0107 0.71 A T = 0.581 T = 0.660 2589515 23883 87395983 G/C G = 0.586 G = 0.544 0.211 0.84 G C = 0.414 C = 0.456 3733367 24132 87396232 C/T C = 1.000 C = 1.000 0.957 0.54 C T = 0.000 T = 0.000 958 24169 87396269 C/T C = 0.833 C = 0.842 0.69 1.07 T T = 0.167 T = 0.158 2589506 25987 87398087 G/A G = 0.568 G = 0.51 0.0657 0.79 G A = 0.432 A = 0.490 1436524 26072 87398172 A/G A = 0.341 A = 0.248 0.00126 0.64 A G = 0.659 G = 0.752 2575672 26376 87398476 C/T C = 0.726 C = 0.814 0.00125 1.65 T T = 0.274 T = 0.186 2589518 26614 87398714 G/A G = 0.806 G = 0.868 0.00984 1.58 A A = 0.194 A = 0.132 3775164 26727 87398827 T/G T = 0.934 T = 0.921 0.523 0.83 T G = 0.066 G = 0.079 2589514 26827 87398927 G/A G = 0.556 G = 0.639 0.0199 1.41 A A = 0.444 A = 0.361 3775166 27084 87399184 T/C T = 0.751 T = 0.833 0.00351 1.65 C C = 0.249 C = 0.167 MAPK10-AB 30965 87403065 G/A G = 0.814 G = 0.861 0.0453 1.42 A A = 0.186 A = 0.139 3775167 32436 87404536 C/T C = 0.845 C = 0.850 0.858 1.04 T T = 0.155 T = 0.150 3822035 32821 87404921 T/A T = 0.998 T = 1.000 0.761 A A = 0.002 A = 0 3775168 32979 87405079 A/T A = 0.380 A = 0.261 0.00252 0.57 A T = 0.620 T = 0.739 3775169 33572 87405672 T/C T = 0.829 T = 0.870 0.106 1.38 C C = 0.171 C = 0.130 2043650 35142 87407242 A/G A = 0.308 A = 0.215 0.00102 0.62 A G = 0.692 G = 0.785 2043649 35237 87407337 T/G T = 0.302 T = 0.241 0.0305 0.73 T G = 0.698 G = 0.759 3775170 36014 87408114 T/A T = 0.791 T = 0.784 0.782 0.96 T A = 0.209 A = 0.216 1541998 36439 87408539 C/T C = 0.283 C = 0.228 0.0604 0.75 C T = 0.717 T = 0.772 MAPK10-AC 36838 87408938 G/A G = 0.034 G = 0.013 0.176 0.36 G A = 0.966 A = 0.987 MAPK10-AD 36889 87408989 G/A G = 0.923 G = 0.958 0.081 1.90 A A = 0.077 A = 0.042 MAPK10-AE 38639 87410739 T/C T = 0.919 T = 0.931 0.491 1.20 C C = 0.081 C = 0.069 2282599 38657 87410757 T/G T = 1.000 T = 1.000 0.976 0.64 T G = 0.000 G = 0.000 MAPK10-AF 38865 87410965 T/C T = 0.300 T = 0.222 0.00536 0.66 T C = 0.700 C = 0.778 MAPK10-AG 38885 87410985 A/G A = 0.249 A = 0.192 0.0626 0.71 A G = 0.751 G = 0.808 MAPK10-AH 38943 87411043 T/C T = 0.945 T = 0.953 0.649 1.17 C C = 0.055 C = 0.047 MAPK10-AI 39035 87411135 T/C T = 0.128 T = 0.058 0.000413 0.41 T C = 0.872 C = 0.942 MAPK10-AJ 39046 87411146 T/C T = 0.823 T = 0.877 0.0241 1.53 C C = 0.177 C = 0.123 2282598 39218 87411318 C/T C = 0.971 C = 0.966 0.735 0.86 C T = 0.029 T = 0.034 2282597 39241 87411341 G/A G = 0.184 G = 0.197 0.613 1.09 A A = 0.816 A = 0.803 3775171 40105 87412205 A/C A = 1.000 A = 1.000 0.998 0.94 A C = 0.000 C = 0.000 3775172 40240 87412340 C/T C = 0.003 C = 0.003 0.995 0.98 C T = 0.997 T = 0.997 3775173 41162 87413262 T/C T = 0.841 T = 0.852 0.652 1.09 C C = 0.159 C = 0.148 3775174 42477 87414577 A/C A = 1.000 A = 0.999 0.947 0.55 A C = 0.000 C = 0.001 1469870 46191 87418291 G/C G = 0.884 G = 0.934 0.013 1.85 C C = 0.116 C = 0.066 1436522 50467 87422567 T/C T = 0.84 T = 0.876 0.122 1.34 C C = 0.160 C = 0.124 1946733 52934 87425034 G/A G = 0.763 G = 0.773 0.709 1.06 A A = 0.237 A = 0.227 983362 54730 87426830 T/C T = 0.002 T = 0.003 0.934 1.40 C C = 0.998 C = 0.997 3755971 58283 87430383 C/T C = 0.001 C = 0.002 0.878 3.66 T T = 0.999 T = 0.998 3822036 58378 87430478 C/G C = 0 C = 0.001 0.944 G G = 1.000 G = 0.999 3775175 59505 87431605 G/A G = 0.001 G = 0.005 0.67 4.64 A A = 0.999 A = 0.995 1436525 60229 87432329 G/A G = 0.945 G = 0.961 0.297 1.43 A A = 0.055 A = 0.039 3822037 61108 87433208 C/G C = 0.054 C = 0.085 0.102 1.61 G G = 0.946 G = 0.915 3775176 62587 87434687 G/A G = 0.034 G = 0.088 0.0283 2.78 A A = 0.966 A = 0.912 993593 63133 87435233 C/T C = 0.998 C = 1.000 0.789 99.16 T T = 0.002 T = 0.000 1436527 63616 87435716 C/T C = 0.709 C = 0.75 0.155 1.23 T T = 0.291 T = 0.250 1436529 65377 87437477 T/C T = 0.448 T = 0.463 0.642 1.06 C C = 0.552 C = 0.537 3775180 65442 87437542 A/C A = 1.000 A = 1.000 0.957 4.50 C C = 0.000 C = 0.000 3775181 65548 87437648 T/G T = 0.758 T = 0.729 0.36 0.86 T G = 0.242 G = 0.271 3775182 65878 87437978 T/G T = 0.143 T = 0.13 0.592 0.90 T G = 0.857 G = 0.870 3775183 66222 87438322 G/A G = 0.446 G = 0.392 0.13 0.80 G A = 0.554 A = 0.608 3775184 66354 87438454 A/G A = 0.828 A = 0.818 0.715 0.94 A G = 0.172 G = 0.182 733245 67224 87439324 A/T A = 0.002 A = 0.003 0.87 2.02 T T = 0.998 T = 0.997 3775185 68198 87440298 T/G T = 0.003 T = 0.001 0.846 0.32 T G = 0.997 G = 0.999 1561154 68729 87440829 T/C T = 0.009 T = 0.008 0.918 0.88 T C = 0.991 C = 0.992 3775186 69058 87441158 A/C A = 0.005 A = 0.005 0.981 0.95 A C = 0.995 C = 0.995

3775187 69527 87441627 T/C T = 0.698 T = 0.71 0.692 1.06 C C = 0.302 C = 0.290 1010778 70774 87442874 A/G A = 0.668 A = 0.724 0.0721 1.31 G G = 0.332 G = 0.276 2282596 71232 87443332 T/A T = 0.265 T = 0.267 0.94 1.01 A A = 0.735 A = 0.733 2282595 71943 87444043 A/C A = 1.000 A = 1.000 0.984 0.00 A C = 0.000 C = 0.000 2118044 73397 87445497 A/T A = 0.656 A = 0.681 0.444 1.12 T T = 0.344 T = 0.319 1469869 76322 87448422 C/T C = 0.615 C = 0.666 0.103 1.24 T T = 0.385 T = 0.334 MAPK10-AK 110704 87482804 A/G A = 0.526 A = 0.488 0.236 0.86 A G = 0.474 G = 0.512

[0309] FIG. 1B shows proximal SNPs in and around the MAPK10 region for females. The position of each SNP on the chromosome is presented on the x-axis. The y-axis gives the negative logarithm (base 10) of the p-value comparing the estimated allele in the case group to that of the control group. The minor allele frequency of the control group for each SNP designated by an X or other symbol on the graphs in FIG. 1B can be determined by consulting Table 19. By proceeding down the Table from top to bottom and across the graphs from left to right the allele frequency associated with each symbol shown can be determined.

[0310] To aid the interpretation, multiple lines have been added to the graph. The broken horizontal lines are drawn at two common significance levels, 0.05 and 0.01. The vertical broken lines are drawn every 20 kb to assist in the interpretation of distances between SNPs. Two other lines are drawn to expose linear trends in the association of SNPs to the disease. The light gray line (or generally bottom-most most curve) is a nonlinear smoother through the data points on the graph using a local polynomial regression method (W. S. Cleveland, E. Grosse and W. M. Shyu (1992) Local regression models. Chapter 8 of Statistical Models in S eds J. M. Chambers and T. J. Hastie, Wadsworth & Brooks/Cole.). The black line provides a local test for excess statistical significance to identify regions of association. This was created by use of a 10 kb sliding window with 1 kb step sizes. Within each window, a chi-square goodness of fit test was applied to compare the proportion of SNPs that were significant at a test wise level of 0.01, to the proportion that would be expected by chance alone (0.05 for the methods used here). Resulting p-values that were less than 10.sup.-8 were truncated at that value.

[0311] Finally, the gene or genes present in the loci region of the proximal SNPs as annotated by Locus Link (http address: www.ncbi.nlm.nih.gov/LocusLink/) are provided on the graph. The exons and introns of the genes in the covered region are plotted below each graph at the appropriate chromosomal positions. The gene boundary is indicated by the broken horizontal line. The exon positions are shown as thick, unbroken bars. An arrow is place at the 3' end of each gene to show the direction of transcription.

Glypican-1 in human breast cancer
Compositions and methods for therapy and diagnosis of breast cancer
Mammaglobin, a mammary-specific breast cancer protein
Method of diagnosing breast cancer and compositions therefor
Use of anastrozole for the treatment of post-menopausal women having early breast cancer
Compositions and methods for the therapy and diagnosis of breast cancer
Treatment of breast cancer
Apparatus and method for breast cancer imaging


20060211023 Method of diagnosing breast cancer and compositions therefor
20060040263 Marker at the androgen receptor gene for determining breast cancer susceptibility
20060014160 Methods for the diagnosis and treatment of breast cancer
20060010554 Psychological support kit for breast cancer patients
20060003021 METHOD OF TREATING BREAST CANCER USING A COMBINATION OF VITAMIN D ANALOGUES AND OTHER AGENTS
20050287588 Breast cancer specific gene 1
20050282146 Methods to predict additional nodal metastases in breast cancer patients
20050272685 Intraductal treatment targeting methylated promoters in breast cancer
20050272684 Breast cancer resistance protein (BCRP) and the DNA which encodes it
20050272651 Methods for treating breast cancer using NRIF3 related molecules
20050272043 Methods for identifying risk of breast cancer and treatments thereof
20050265971 Agent for treatment of breast cancer and pancreatic cancer comprising herpes simplex virus mutant
20050256208 Pharmaceutical composition containing bakuchiol for treating woman breast cancer
20050255504 Method of detecting an increased susceptibility to breast cancer
20050240089 Method and computer program for assessing breast cancer risk
20050239083 Predicting breast cancer treatment outcome
20050239079 Predicting outcome with tamoxifen in breast cancer
20050228038 11-Beta hydroxysteroid dehydrogenase type 1 inhibitors as anti-obesity/anti-diabetes compounds and 17-beta hydrosteroid dehydrogenase type I inhibitors as useful agents for the treatment of cancers, especially breast cancer
20050222100 Treatment of post-menopausal complaints in breast cancer patients comprising tibolone and a serm
20050214771 Methods for identifying risk of breast cancer and treatments thereof
20050208500 Signatures of ER status in breast cancer
20050192239 Methods for identifying risk of breast cancer and treatments thereof
20050186610 Breast cancer related protein, gene encoding the same, and method of diagnosing breast cancer using the protein and gene
20050186577 Breast cancer prognostics
20050170352 Use of biomarkers to detect breast cancer

Copyright © 2006 - 2015 Patent Information Search