Patent Search

 
 

Method of using estrogen-related receptor alpha (ERRalpha) status to determine prognosis, treatment strategy and predisposition to breast cancer, and method of using ERRalpha as a therapeutic target for the treatment of breast cancer

Abstrict

The present invention provides that ERR.alpha. is a breast cancer biomarker of clinical course and treatment sensitivity and, itself, a target for breast cancer treatment. A high ERR.alpha. level in breast cancer indicates poor prognosis. Analyzing ERR.alpha. expression level along with the status of ER.alpha. and ErbB2 can help breast cancer patients make treatment choices. Furthermore, breast cancer can be treated by modulating ERR.alpha. activity.

Claims

We claim:

1. A method for determining prognosis of a breast cancer patient comprising the step of determining the level of estrogen-related receptor (ERR) .alpha. expression in breast cancer cells wherein a high level indicates a poor prognosis and a low level indicates a more favorable prognosis.

2. A method for categorizing breast cancer patients based on ERR.alpha. status comprising the step of determining the expression level of ERR.alpha. in the breast cancer cells of a breast cancer patient.

3. The method of claim 2 further comprising the step of identifying a breast cancer patient as unlikely to respond to hormonal blockade therapy if the breast cancer cells express ERR.alpha. at a high level.

4. The method of claim 2 further comprising the step of identifying a breast cancer patient as likely to respond to hormonal blockade therapy if the breast cancer cells express ERR.alpha. at a low level.

5. The method of claim 2, wherein the expression level of ERR.alpha. is determined by measuring ERR.alpha. mRNA.

6. The method of claim 2, wherein the expression level of ERR.alpha. is determined by measuring ERR.alpha. protein.

7. The method of claim 2 further comprising the step of determining the expression level of estrogen receptor (ER) .alpha. in the breast cancer cells of a breast cancer patient.

8. The method of claim 7 further comprising the step of identifying a breast cancer patient as unlikely to respond to hormonal blockade therapy if the breast cancer cells express ERR.alpha. at a level higher than or similar to ER.alpha..

9. The method of claim 7 further comprising the step of identifying a breast cancer patient as likely to respond to hormonal blockade therapy if the breast cancer cells express ERR.alpha. at a level lower than ER.alpha..

10. The method of claim 7, wherein the expression level of at least one of ERR.alpha. and ER.alpha. is determined by measuring mRNA.

11. The method of claim 7, wherein the expression level of at least one of ERR.alpha. and ER.alpha. is determined by measuring protein.

12. The method of claim 2 further comprising the step of determining the expression level of ErbB2 in the breast cancer cells of a breast cancer patient.

13. The method of claim 12 further comprising the step of identifying a breast cancer patient as likely to respond to ErbB2-based therapy if the breast cancer cells of the patient express ErbB2 at a high level and ERR.alpha. at a high level.

14. The method of claim 12 further comprising the step of identifying a breast cancer patient as unlikely to respond to ErbB2-based therapy if the breast cancer cells of the patient express ErbB2 at a high level and ERR.alpha. at a low level.

15. The method of claim 12, wherein the expression level of at least one of ERR.alpha. and ErbB2 is determined by measuring mRNA.

16. The method of claim 12, wherein the expression level of at least one of ERR.alpha. and ErbB2 is determined by measuring protein.

17. A method for identifying a human subject for further breast cancer examination comprising the step of determining whether a mutation exists in the ERR.alpha. gene.

18. A method for identifying a human subject for further breast cancer examination comprising the step of determining whether an aberrantly spliced mRNA variant of ERR.alpha. exists.

19. A method for treating breast cancer comprising the steps of: determining whether ERR.alpha. is an activator or repressor of ERE-dependent transcription in breast cancer cells; and decreasing ERR.alpha. activity in breast cancer cells if ERR.alpha. is an activator and increasing ERR.alpha. activity in breast cancer cells if ERR.alpha. is a repressor.

20. The method of claim 19, wherein decreasing ERR.alpha. activity is achieved by decreasing the amount of ERR.alpha. mRNA or protein and increasing ERR.alpha. activity is achieved by increasing the amount of ERR.alpha. mRNA or protein.

21. The method of claim 19, wherein decreasing ERR.alpha. activity is achieved by treating breast cancer cells with an ERR.alpha. antagonist and increasing ERR.alpha. activity is achieved by treating breast cancer cells with an ERR.alpha. agonist.

22. The method of claim 19, wherein decreasing ERR.alpha. activity is achieved by inhibiting ErbB signaling pathway in breast cancer cells.

23. The method of claim 19, wherein decreasing ERR.alpha. activity is achieved by introducing a dominant-negative variant of ERR.alpha. into breast cancer cells.

24. A method for identifying an agent that modulates ERR.alpha. expression, the method comprising the steps of: treating cells that express ERR.alpha. with a test agent; comparing the level of ERR.alpha. expression in the treated cells to that of control cells that are not treated with the agent.

25. The method of claim 24, wherein the level of expression is determined at the mRNA level.

26. The method of claim 24, wherein the level of expression is determined at the protein level.

27. A method for identifying an agent that modulates ERR.alpha. activity in a cell, the method comprising the steps of: treating cells that contain ERR.alpha. with a test agent; and comparing ERR.alpha. activity in the treated cell to that of control cells that are not treated with the agent.

28. The method of claim 27, wherein the ERR.alpha. activity is activating or repressing transcription.

29. A method for identifying an agonist or an antagonist of ERR.alpha., the method comprising the steps of: exposing ERR.alpha. to a test agent; determining whether the agent binds to ERR.alpha.; treating cells that express ERR.alpha. with a test agent determined to bind to ERR.alpha.; and comparing ERR.alpha. activity in the treated cell to that of control cells that are not treated with the agent.

30. The method of claim 29, wherein the ERR.alpha. activity is activating or repressing transcription.

Description

CROSS-REFERENCE TO RELATED APPLICATION

[0001] This application is a continuation-in-part application of U.S. patent application Ser. No. 09/488,730, filed on Jan. 20, 2000, which is a continuation-in-part application of U.S. patent application Ser. No. 09/031,250, filed on Feb. 26, 1998, now abandoned, which claims the benefit of U.S. provisional patent application Serial No. 60/033,808, filed on Feb. 27, 1997, all of which are herein incorporated by reference in their entirety.

BACKGROUND OF THE INVENTION

[0003] The steroid/thyroid hormone nuclear receptor superfamily consists of a large number of transcription factors that regulate a wide variety of cellular processes (reviewed in Mangelsdorf, D. J., et al., Cell 83:835-839, 1995). The most highly conserved region of these proteins is their DNA binding domain (DBD) which contains two zinc finger modules. The DBD of hormone receptors interacts with a six nucleotide core recognition motif, or half-site, resembling the sequence 5'-AGGTCA-3'. Most members of the superfamily homo- and/or heterodimerize with other members of this superfamily, thus binding to two half-sites. The orientation and spacing between the half-sites provides the primary basis for specific DNA binding (reviewed in Glass, C. K., Endocrine Rev. 15:391-407, 1994). However, some members of this superfamily can bind to a single extended half-site version of this sequence (Scearce, L. M., et al., J. Biol. Chem. 268:8855-8861, 1993; Wilson, T. E., et al., Mol. Cell. Biol. 13:5794-5804, 1993; Harding, H. P., and Lazar, M., Mol. Cell. Biol. 15:4791-4802, 1995; Gigure, V., et al., Mol. Cell. Biol. 15:2517-2526, 1995). For example, an optimal binding site for steroidogenic factor 1 (SF-1) contains the sequence 5'-TCAAGGTCA-3' (Wilson, T. E., et al., supra, 1993).

[0004] Ligands for many members of the superfamily have been well-studied; they include the steroid hormones, thyroid hormones, retinoids and vitamin D.sub.3. Other members of the superfamily have no known ligand; they are referred to as "orphan" receptors. Orphan receptors can bind DNA as heterodimers, homodimers, or monomers (reviewed in Mangelsdorf, D. J., and Evans, R. M., Cell 83:841-850, 1995).

[0005] The human estrogen-related receptor .alpha. (hERR.alpha. or human ERR.alpha., officially termed NR3B1, Nuclear Receptors Nomenclature Committee, Cell 97:161-163, 1999; in the specification these terms are used interchangeably) is an orphan member of the steroid/thyroid hormone nuclear recepotor superfamily. cDNAs encoding portions of this protein and human ERR.beta. (officially termed NR3B2 (Cell 97:161-163, 1999); in the specification ERR.beta. and NR3B2 are used interchangeably) were initially isolated by a reduced-stringency screening of cDNA libraries with probes corresponding to the DBD of the human estrogen receptor .alpha. (ER.alpha. (officially termed NR3A1 (Cell 97:161-163, 1999)) formerly ER; in the specification, these two terms are used interchangeably) (Gigure, V., et al., Nature 331:91-94, 1988). Using chimeric receptors in transfected cells, Lydon, et al. (Lydon, J. P., et al., Gene Express. 2:273-283, 1992) demonstrated that ERR.alpha. contains a transcriptional activation domain. On the basis of amino acid sequence similarity with the receptor SF-1 in part of the DBD, Wilson, et al. (Wilson, T. E., et al., supra, 1993) predicted that ERR.alpha. might bind to the extended half-site sequence 5' TCAAGGTCA-3' recognized by SF-1. Yang, t al. (Yang, N., et al., J. Biol. Chem. 271:5795-5804, 1996) isolated new cDNA clones encoding most of mouse ERR.alpha. by screening a cDNA expression library for proteins capable of binding to sequences present in the promoter region of the lactoferrin gene.

[0006] Previously, Wiley, et al. reported the purification of proteins from a HeLa cell nuclear extract that bind the transcriptional initiation site of the major late promoter (MLP) of simian virus 40 (SV40) (Wiley, S. R., et al., Genes Dev. 7:2206-2219, 1993). These proteins, collectively referred to as IBP-s for initiator binding proteins of SV40, were shown to consist of multiple members of the steroid/thyroid hormone receptor superfamily (Wiley, S. R., supra, 1993; Zuo, F., and Mertz, J. E., Proc. Natl. Acad. Sci. USA 92:8586-8590, 1995). Partial peptide sequence analysis indicated that a major component of IBP-s was ERR.alpha. (Wiley, S. R., supra, 1993). Thus, at least one binding site for ERR.alpha. has been identified in the SV40 late promoter.

[0007] To identify functional activities of IBP-s, we performed a variety of genetical and biochemical experiments (Wiley, S. R., supra, 1993; Zuo, F., and Mertz, J. E., supra, 1995). The data from these experiments indicated the following: (i) The SV40 MLP contains at least two high-affinity binding sites for IBP-s situated immediately surrounding (+1 site) and approximately 55 bp downstream of (+55 site) the transcriptional start site. (ii) These high-affinity binding sites include the consensus half-site sequence 5'-AGGTCA-3'. (iii) The binding of IBP-s to these sites results in repression of transcription from the SV40 late promoter both in transfected CV-1 cells (derived from SV40's natural host) and in a cell-free transcription system. (iv) Transfection of CV-1 cells with a plasmid encoding an ER.alpha.-ERR.alpha. chimeric protein containing all but the first 38 amino acid residues of ERR.alpha. results in sequence-specific super-repression of the SV40 late promoter. Thus, ERR.alpha. likely possesses the functional activities of IBP-s.

[0008] Breast cancer afflicts one in eight women in the United States over their lifetime (Edwards, B. K., et al., Cancer 94:2766-2792, 2002). ER.alpha. mediates estrogen responsiveness (reviewed in Sanchez, R., et al., Bioessays 24: 244-254, 2002) and plays crucial roles in the etiology of breast cancer (reviewed in Russo, J., et al., J Natl Cancer Inst Monogr. 27:17-37, 2000). It has been developed into the single most important genetic biomarker and target for breast cancer therapy. ER.alpha. is present at detectable levels by ligand-binding and immunohistochemical assays in approximately 75% of clinical breast cancers. Selection of patients with ER.alpha.-positive breast tumors increases endocrine-based therapy response rates from about one-third in unselected patients to about one-half in patients with ER.alpha.-positive tumors (Clark, G. M. and McGuire, W. L., Breast Cancer Res Treat. 3:S69-72, 1983). Since expression of progesterone receptor (PgR, officially termed NR3C3 (Cell 97:161-163, 1999)) is dependent upon ER.alpha. activity, further selection of patients with ER.alpha.- and PgR-positive tumors enhances the breast cancer hormonal therapy response rate to nearly 80% (Clark, G. M. and McGuire, W. L., Breast Cancer Res Treat. 3: S69-72, 1983). Although ER.beta. (officially termed NR3A2 (Cell 97:161-163, 1999)) also mediates responses to estrogens (reviewed in Sanchez, R., et al., Bioessays 24: 244-254, 2002), its roles in breast cancer are not as well understood. Reports have linked ER.beta. expression with low tumor aggressiveness (Jarvinen, T. A., et al. Am J Pathol. 56:29-35, 2000) and higher levels of proliferation markers in the absence of ER.alpha. (Jensen, E. V., et al., Proc Natl Acad Sci. USA 98:25197-15202, 2001).

[0009] Members of the ErbB family of transmembrane tyrosine kinase receptors have been implicated in the pathogenesis of breast cancer. The members include epidermal growth factor receptor (EGFR, also HER1; ErbB1), ErbB2 (HER2; Neu), ErbB3 (HER3) and ErbB4 (HER4) (reviewed in Stern, D. F., Breast Cancer Res. 2:176-183, 2000). ErbB members stimulate signal transduction pathways that involve mitogen-activated protein kinase (MAPK). In response to initial binding of epidermal growth factor (EGF)-like peptide hormones, ErbB members form homodimers and heterodimers in various combinations to recruit distinct effector proteins (reviewed in Olayioye, M. A., Breast Cancer Res. 3:385-389, 2001). Although ErbB2 has not been demonstrated to interact directly with peptide hormones, it serves as a common regulatory heterodimer subunit with other ligand-bound ErbB members (reviewed in Klapper, L. N., et al., Proc Natl Acad Sci. USA 96: 4995-5000, 1999; Klapper, L. N., et al., Adv Cancer Res. 77:25-79, 2000). Unlike the other ErbB members, ErbB3 lacks intrinsic kinase activity and, therefore, is required to heterodimerize with other ErbB members to participate in signaling (Guy, P. M., et al., Proc Natl Acad Sci. USA 91: 8132-8136, 1994).

[0010] Independent overexpression of either EGFR (reviewed in Klijn, J. G., et al., Endocr Rev. 13:3-17, 1992) or ErbB2 (reviewed in Hynes, N. E. and Stern, D. F. Biochim Biophys Acta. 1198:165-184, 1994) associates with ER-negative tumor status, indicates aggressive tumor behavior, and predicts poor prognosis. Moreover, patients whose tumors coexpress both EGFR and ErbB2 exhibit a worse outcome than patients with tumors that overexpress only one of these genes (Torregrosa, D., et al. Clin Chim Acta. 262:99-119, 1997, Suo, Z., et al. J Pathol. 196:17-25, 2002). Overexpression of ErbB2, most often due to gene amplification, occurs in approximately 15-30% of all breast cancers (Slamon, D. J., et al., Science 235:177-182, 1987), reviewed in (Hynes, N. E. and Stern, D. F., Biochim Biophys Acta. 1198:165-184, 1994). Some (Wright, C., et al., Br J Cancer 65:118-121, 1992; Borg, A., et al., Cancer Lett. 81:137-144, 1994; Newby, J. C., et al., Clin Cancer Res. 3:1643-1651, 1997; Houston, et al., Br J Cancer 79:1220-1226, 1999; Dowsett, M., et al., Cancer Res. 61:8452-8458, 2001; Lipton, A., et al., J Clin Oncol. 20:1467-1472, 2002), but not all reports (Elledge, R. M., et al., Clin Cancer Res. 4:7-12, 1998; Berry, D., et al., J Clin Oncol. 18: 3471-3479., 2000.), have implicated ErbB2 in the development of resistance to antiestrogens.

[0011] ErbB2 has been targeted for development of the successful clinical agent Herceptin (trastuzumab), a recombinant humanized monoclonal antibody directed against this receptor's ectodomain (reviewed in Sliwkowski, M. X., et al., Semin Oncol, 26: 60-70, 1999). Herceptin has been shown to be a suitable option as a first-line single-agent therapy (Vogel, C., et al., J Clin Oncol. 20:719-726, 2002), but will likely prove most beneficial as an adjuvant (Slamon, D. J., et al., N Engl J Med. 344:783-792, 2001; Esteva, F. J., et al., J Clin Oncol. 20:1800-1808, 2002). Clinical trials are currently underway to evaluate the combination of Herceptin with antiestrogens as a rational approach to treating ER.alpha.-positive/ErbB2-overexpressing tumors (Lipton, A., et al., J Clin Oncol. 20:1467-1472, 2002). In the near future, Herceptin will also likely be evaluated in combination with the small molecule EGFR tyrosine kinase inhibitor ZD1829 (Iressa), since this ATP-mimetic has been shown to almost completely block transphosphorylation of ErbB2 via heterodimerization with EGFR in intact cells (Moulder, S. L., Yakes, et al., Cancer Res. 61:8887-8895, 2001) and inhibits the growth of breast cancer cell lines overexpressing both EGFR and ErbB2 (Normanno, N., et al., Ann Oncol. 13:65-72, 2002). Hence, a combination of ZD1829 and Herceptin may be particularly beneficial to those patients whose tumors coexpress EGFR and ErbB2.

[0012] The ability of ErbB3 and ErbB4 to predict clinical course is not as clearly recognized as that of EGFR and ErbB2. ErbB3 has been observed at higher levels in breast tumors than normal tissues, showing associations with unfavorable prognostic indicators including ErbB2 expression (Gasparini, G., et al., Eur J Cancer 1:16-22, 1994), lymph node-positive status (Lemoine, N. R., et al., Br J Cancer 66:1116-1121, 1992), and tumor size. However, it also associated with ER.alpha.-positive status, a favorable marker of hormonal sensitivity (Knowlden, J. M., et al., Oncogene 17:1949-1957, 1998). In stark contrast to ErbB2, higher levels of ErbB4 have been associated with ER.alpha.-positive status (Knowlden, J. M., et al., Oncogene 17:1949-1957, 1998; Bacus, S. S., et al., Am J Pathol. 148:549-558, 1996), more differentiated histotypes (Kew, T. Y., et al., Br J Cancer 82:1163-1170, 2000) and a more favorable outcome (Suo, Z., et al., J Pathol. 196:17-25, 2002).

[0013] Despite the utility of ERs and ErbB members as indicators of clinical course, there remains a great need to identify additional breast cancer biomarkers.

BRIEF SUMMARY OF THE INVENTION

[0014] The present invention discloses that ERR.alpha. is both a breast cancer biomarker and a breast cancer treatment target. In one embodiment, the present invention is a method of determining prognosis of breast cancer by determining the level of ERR.alpha. in the breast cancer tissue. A high level of ERR.alpha. indicates poor prognosis.

[0015] In another embodiment, the present invention is method of categorizing breast cancer patients for treatment purposes by determining the status of ERR.alpha., and optionally the status of one or more of ER.alpha., PgR, ErbB2, in the breast cancer tissue.

[0016] In another embodiment, the present invention is a method of treating breast cancer by modulating ERR.alpha. activities. If ERR.alpha. is an activator of ERE-dependent transcription in a particular breast cancer, the treatment calls for decreasing the levels or activity of ERR.alpha.. If ERR.alpha. is a repressor of ERE-dependent transcription in a particular breast cancer, the treatment calls for increasing the levels or activity of ERR.alpha..

[0017] In another embodiment, the present invention is a method of identifying an individual for further breast cancer examination by screening for mutations in the ERR.alpha. gene.

[0018] It is an object of the present invention to identify more biomarkers and treatment targets for breast cancer.

[0019] It is an advantage of the present invention that the biomarker identified can predict prognosis and help patients make treatment choices.

[0020] Other objects, advantages, and features of the present invention will become apparent from the following detailed description of the invention.

BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS

[0021] FIGS. 1A and B are schematic diagrams of human ERR.alpha.. DBD and LBD denote the DNA binding and ligand binding domains, respectively. A, Structure of ERR.alpha. protein. ERR.alpha.1, except for lacking the first 97 amino acids, is the same as "full-length" ERR.alpha. described by Gigure, et al. (Gigure, V., et al., supra, 1988). The positions of the DBD and LBD are indicated, as are the percentages of amino acid identity between ERR.alpha.1 and ER.alpha. for each of these domains. Structures of the probes used in the experiments presented in FIG. 3 are shown at the bottom; the 5'-ends correspond to the regions encoding the amino acid residues of ERR.alpha.1, and the wavy line indicates sequences discontinuous with the ERR.alpha. cDNA. B, Structure of ERR.alpha. cDNA and its transcripts. The boxes numbered 1-7 indicate the locations and sizes of the exons. The coordinates refer to the nucleotides.

[0022] FIGS. 2A and B are radiographic images of electrophoretic gels that demonstrate the size of ERR.alpha.1 in human HeLa cells. FIG. 2A represents proteins present in a HeLa cell nuclear extract and synthesized from an ERR.alpha.1 cDNA clone by in vitro transcription and translation ("TNT") that were detected by immunoblotting with an antiserum directed against GST-ERR.alpha.1.sub.117-329. FIG. 2B represents HeLa cells that were metabolically labeled with [.sup.35S]-methionine and -cysteine for 4 hours before being washed and lysed and their ERR.alpha.-related radiolabeled proteins collected by immunoprecipitation with the antisera indicated.

[0023] FIGS. 3A and B are radiographic images of electrophoretic gels displaying the major species of ERR.alpha. mRNA present in HeLa cells. FIG. 3A depicts S1 nuclease mapping analysis of ERR.alpha. mRNA using the probe shown in FIG. 1A. FIG. 3B depicts primer extension analysis of ERR.alpha. mRNA using the probe shown in FIG. 1A.

[0024] FIG. 4 is a radiographic image of gel-mobility-shift assays showing sequence-specific binding of recombinant ERR.alpha.1 protein.

[0025] FIG. 5 tabulates relative affinities of ERR.alpha. for DNA sequences from a variety of cellular and viral promoters.

[0026] FIGS. 6A and B are radiographic images that demonstrate that ERR.alpha. binds to the extended half-site sequences present in the SV40-MLP. FIG. 6A is a set of autoradiograms of DNase I footprints of GST-ERR.alpha.1 bound to the +1 and +55 sites of the SV40-MLP. FIG. 6B is a set of autoradiograms of hydroxyl radical footprints of GST-ERR.alpha.1 bound to the +55 site of the SV40-MLP in isolation from other ERR.alpha.-binding sites. FIG. 6C summarizes the nucleotides of the SV40-MLP protected by ERR.alpha. as determined from the data in panels A and B.

[0027] FIG. 7 is a radiographic image of an electrophoretic gel demonstrating that GST-ERR.alpha.1 sequence-specifically represses transcription from the SV40-MLP and minor late promoters in a cell-free system.

[0028] FIG. 8 is a radiographic image of an electrophoretic gel demonstrating that ERR.alpha. represses transcription from the SV40 late promoter in vivo.

[0029] FIGS. 9A and B are radiographic images of electrophoretic gels demonstrating that ERR.alpha. associates in vitro with TFIIB and ER.alpha.. In FIG. 9A, ER.alpha. was fused to GST with ERR.alpha.1 made in reticulocyte lysates. FIG. 9B is the reciprocal experiment in which ER.alpha. was retained by GST-ERR.alpha.1.

[0030] FIG. 10A is a radiographic image of an electrophoretic gel demonstrating that association of ERR.alpha. with ER.alpha. occurs via the C-terminus of ERR.alpha.. FIG. 10B shows the quantitation of the ER.alpha.-ERR.alpha. protein-protein interactions in FIG. 10A.

[0031] FIG. 11 is a radiographic image of an electrophoretic gel demonstrating that ERR.alpha. binds to some naturally occurring estrogen-responsive elements with higher affinity than does ER.alpha., including the ERE of the pS2 gene, overexpression of which correlates with malignant breast cancer.

[0032] FIG. 12 is a schematic representation of ER and ERR family members. A, comparison of the sequence similarity between human ER.alpha. and human ERR.alpha.1. The letters A-F indicate the domains typically found in NRs. DBD and LBD denote the DNA binding and ligand binding domains, respectively. The numbers refer to the amino acid residues. The percentages indicate the amino acid sequence similarity between the corresponding domains of the two proteins, with ER.alpha. sequences set at 100%. B, structures of the variants of ERR.alpha.1 studied here. Amino acid substitution mutations are indicated at the sites of the numbered residues.

[0033] FIG. 13 shows binding of ERR.alpha. to a consensus ERE and its ability to exclude ER.alpha. from binding DNA. A, both ERR.alpha.1 and ER.alpha. bind efficiently to an ERE. Approximately 5 .mu.g of whole-cell extract obtained from COS-M6 cells overexpressing ERR.alpha.1 or ER.alpha. was incubated with the radiolabeled, double-stranded oligonucleotide corresponding to the sequence 5'-TAAGCTTAGGTCACAGTGACCTAA- GCTTA-3' (ERE core half-site sequences are underlined). The protein-DNA complexes were separated by electrophoresis in a native 5% polyacrylamide gel. Lane 1, probe alone; lane 2, ER.alpha.-containing extract; lane 5, ERR.alpha.1-containing extract; lanes 3, ER.alpha.-containing extract plus the ER.alpha.-specific antibody H222; lane 4, ER.alpha.-containing extract plus an ERR.alpha.1-specific polyclonal antiserum (11); lane 6, ERR.alpha.1-containing extract plus ER.alpha.-specific antibody H222; lane 7, ERR.alpha.1-containing extract plus ERR.alpha.1-specific polyclonal antiserum. The arrows indicate the specific DNA-protein complexes and free probe DNA. The asterisk denotes antibody-supershifted complexes. B, ER.alpha. and ERR.alpha.1 compete for binding to the ERE. The radiolabeled ERE probe was incubated with a constant amount of whole-cell extract containing ER.alpha. by itself (lane 2) or with increasing amounts of whole-cell extract containing ERR.alpha.1 (lanes 3-6). Lanes 7 and 8 contained 2.5 .mu.g of ER.alpha.-containing extract plus 2.5 .mu.g of ERR.alpha.1-containing extract preincubated with ER.alpha.-specific antibody or hERR.alpha.1-specific polyclonal antiserum, respectively.

[0034] FIG. 14 shows down-modulation of ERE-dependent, ER-stimulated transcription by ERR.alpha. in MCF-7 cells. A, schematic representations of the pTK-luc and p3xERE-TK-luc reporter plasmids. Plasmid pTK-luc contains a minimal TK promoter, indicated by the shaded box, located immediately upstream of luciferase-encoding sequences, indicated by the open box. The numbers indicate nucleotides relative to the transcription initiation site. Plasmid p3xERE-TK-luc is identical in sequence to plasmid pTK-luc except for the insertion of three tandem copies of the consensus palindromic ERE sequence 5'-TAAGCTTAGGTCACAGTGACCTAAGCTTA-3', indicated by the hatched boxes. B, ERR.alpha. down-modulates ER-stimulated transcription in MCF-7 cells. MCF-7 cells were co-transfected in parallel with 0.5 .mu.g of pTK-luc or p3xERE-TK-luc and 0.12 or 0.25 .mu.g of pcDNA3.1-hERR.alpha.1 or its empty parental vector pcDNA3.1. After incubation for 48 h in medium containing FBS, the cells were harvested and assayed for luciferase activity, with normalization to the protein concentration of each extract. The data are presented relative to the activity observed in the cells co-transfected with pTK-luc and 0.12 .mu.g of vector pcDNA3.1. They represent the means plus S.E. from three separate experiments. The black bar represents data obtained from cells incubated in the presence of 1.times.10.sup.-6 M anti-estrogen ICI-182,780. C, ERR.alpha. does not affect transcription of ERE-negative pTK-luc in MCF-7 cells. The data are taken from panel B but with the ordinate greatly expanded.

[0035] FIG. 15 shows that ERR.alpha. down-modulates estrogen responsiveness. MCF-7 cells were co-transfected in parallel with 0.5 .mu.g of pTK-luc or p3xERE-TK-luc and 0.12 or 0.25 .mu.g of pcDNA3.1-hERR.alpha.1 or its empty parental vector pcDNA3.1. The cells were subsequently incubated for 48 h in medium supplemented with charcoal-stripped FBS only (A) plus 1.times.10.sup.31 10 M 17.beta.-estradiol (B) or plus 1.times.10.sup.-8 M 17.beta.-estradiol (C) before being harvested and assayed for luciferase activity. The data are presented relative to the activity observed in the cells co-transfected with pTK-luc and 0.12 .mu.g of vector pcDNA3.1 and maintained in medium supplemented with charcoal-stripped FBS only. They are the means plus S.E. of data obtained from three separate experiments. The black bars represent data from cells incubated in the presence of 1.times.10.sup.-6 M of the anti-estrogen ICI-182,780.

[0036] FIG. 16 shows DNA binding properties of variants of ERR.alpha.1. A, immunoblot of wild-type and variants of ERR.alpha.1 expressed in COS-M6 cells. Whole-cell extracts were prepared from COS-M6 cells transfected with the indicated expression plasmids. Five to 10 .mu.g of whole-cell extract was analyzed for ERR.alpha.1-cross-reacting material by SDS-PAGE and immunoblotting as described under "Materials and Methods" in Example 2. Lane 1, pcDNA3.1; lane 2, pcDNA3.1-hERR.alpha.1; lane 3, pcDNA3.1-hERR.alpha.1.sub.P-box; lane 4, pcDNA3.1-hERR.alpha.1.sub.1-173; lane 5, pcDNA3.1-hERR.alpha..sub.176-423 (15 to 30 .mu.g); and lane 6, pcDNA3.1-hERR.alpha.1.sub.413A/418A. FL, full-length B, EMSAs showing DNA binding activities of wild type and variants of ERR.alpha.1 to the palindromic ERE. Approximately 5 .mu.g of protein from whole-cell extracts analyzed in panel A was incubated with the radiolabeled ERE probe as described in the legend to FIG. 13. The protein-DNA complexes were separated by electrophoresis in a native 5% polyacrylamide gel. To identify the DNA-protein complexes, the extracts were incubated with an ERR.alpha.1-specific antiserum before the addition of the probe in lanes 3, 6, 8, and 10. The arrows show the locations of the specific DNA-protein complexes and the free probe.

[0037] FIG. 17 shows competition between ERR.alpha.1 variants and ER.alpha. or ERR.alpha.1 for binding to the palindromic consensus ERE. A, ERR.alpha.1.sub.1-173, but not ERR.alpha.1.sub.P-box, competes with ER.alpha. for binding to the ERE. The radiolabeled ERE probe was incubated with a constant amount of whole-cell extract expressing ER.alpha. alone (lane 2) or together with increasing amounts of whole-cell extract containing overexpressed ERR.alpha.1.sub.1-173 (lanes 4-6) or ERR.alpha.1.sub.P-box (lanes 7-9). Lane 1, probe alone; lane 3, extract was preincubated with the ER.alpha.-specific antibody, H222. The arrows indicate the specific and nonspecific (NS) DNA complexes and free probe. B, ERR.alpha.1.sub.1-173, but not ERR.alpha.1.sub.P-box, competes with wild-type ERR.alpha.1 for binding to the ERE. Experiments were performed as described in panel A above but with a constant amount of whole-cell extract containing overexpressed wild-type ERR.alpha.1 in place of ER.alpha..

[0038] FIG. 18 shows that ERR.alpha. represses transcription by an active silencing mechanism. MCF-7 cells were co-transfected with 0.5 .mu.g of (A) pTK-luc or (B) p3xERE-TK-luc and 0.12 .mu.g or 0.25 .mu.g of the empty vector pcDNA3.1, pcDNA3.1-hERR.alpha.1, pcDNA3.1-hERR.alpha.1.sub.1- -173, pcDNA3.1-hERR.alpha.1.sub.76-423, pcDNA3.1-hERR.alpha.1.sub.413A/418- A, or pcDNA3.1-hERR.alpha.1.sub.P-box. After incubation for 48 h in medium containing whole FBS, the cells were harvested, and luciferase activity was determined with normalization to the protein concentration of each extract. The data are presented in panel A relative to the activity observed with pTK-luc plus 0.12 .mu.g of pcDNA3.1; they are presented in panel B relative to the activity observed with p3xERE-TK-luc plus 0.12 .mu.g pcDNA3.1. All data shown represent means plus the S.E. from three separate experiments, each performed in triplicate.

[0039] FIG. 19 shows that ERR.alpha. activates rather than represses ERE-dependent transcription in HeLa cells. Experimental details are identical to the ones described in FIG. 14, except that ER-negative HeLa cells were used in place of ER-positive MCF-7 cells. The data in panels A and B are presented in the same format as in FIG. 14, panels B and C, respectively.

[0040] FIG. 20 is a model for ERR.alpha. modulation of estrogen responsiveness. See "Discussion" in Example 2 for details. The subscript rep denotes ERR.alpha. that is functioning as a repressor; the subscript act denotes ERR.alpha. that is functioning as an activator. Plus (+) and minus (-) symbols indicate relative levels of ERE-dependent transcription.

[0041] FIG. 21 shows gene expression distributions of ER and ERR family members (A) and ErbB family members (B). Expression levels are depicted as the 95% confidence intervals of the medians of log.sub.2-transformed values.

[0042] FIG. 22 shows ER family member mRNA levels (A for ER.alpha. levels and B for ER.beta. levels) in normal MECs, breast tumors, and tumors segregated by ER-LB and PgR-LB status. Horizontal bars represent the median values. Solid symbols indicate tumors expressing mRNAs at very high (10-fold above), high (above) and low (below) levels relative to the range of expression observed in normal MECs. Statistical significance was determined by the non-parametric Kruskal-Wallis ANOVA.

[0043] FIG. 23 shows ErbB family member mRNA levels (A for EGFR levels, B for ErbB2 levels, C for ErbB3 levels and D for ErbB4 levels) in normal MECs, breast tumors, and tumors segregated by ligand-binding ER and PgR (ER-LB and PgR-LB) status. Horizontal bars represent the median values. Solid symbols indicate tumors expressing mRNAs at very high (10-fold above), high (above), low (below) and very low (10-fold below) levels relative to the range of expression observed in normal MECs. Triangles indicate tumors expressing atypical mRNA levels relative to the standard deviation surrounding the mean expression level in the tumor group. Statistical significance was determined by the non-parametric Kruskal-Wallis ANOVA.

[0044] FIG. 24 shows ERR family member mRNA levels (A for ERR.alpha. levels, B for ERR.beta. levels and C for ERR.gamma. levels) in normal MECs, breast tumors, and tumors segregated by ER-LB and PgR-LB status. Horizontal bars represent the median values. Solid symbols indicate tumors expressing mRNAs at very high (10-fold above), high (above), and low (below) levels relative to the range of expression observed in normal MECs. Triangles indicate tumors expressing atypical mRNA levels relative to the standard deviation surrounding the mean expression level in the tumor group. Statistical significance was determined by the non-parametric Kruskal-Wallis ANOVA.

[0045] FIG. 25 shows ER.alpha. and ERR.alpha. mRNA levels within the same tissue sample. Significance was assessed by 1-way ANOVA with repeated measures on log.sub.2-transformed values.

DETAILED DESCRIPTION OF THE INVENTION

[0046] In the specification and claims, the term "status" of ERR.alpha., ER.alpha., PgR and ErbB2 refers to the "expression status" of these genes. The status can be determined either at the mRNA level or at the protein level, and either qualitatively (expressed or not expressed) or quantitatively (the level of expression). For ErbB2, the "expression status" can also be assessed directly by determining whether the gene is amplified at DNA level. There are many methods known to a skilled artisan that can be used in the present invention to determine the status of ERR.alpha., ER.alpha., PgR and ErbB2. As an example, the status of ER.alpha. and PgR was determined by the ligand binding assays in Example 3 below. ERR.alpha. may be expressed as one of the two isoforms, ERR.alpha.1 and ERR.alpha.2. Unless specifically mentioned, the status of ERR.alpha. in the specification and claims refers to the cumulative expression status of both ERR.alpha.1 and ERR.alpha.2. For example, to assess the ERR.alpha. expression status, primers that can amplify both ERR.alpha.1 and ERR.alpha.2 were used in Example 3 below. When the level of ERR.alpha., ER.alpha. or ErbB2 is referred to as high or low in the specification and claims, it is measured against a median level of ERR.alpha., ER.alpha. or ErbB2 obtained from breast cancer tissues of different patients. The more the breast cancer tissue samples of different breast cancer patients are used to establish the median level, the more accurate the median level is. Preferably, the median level is obtained from analyzing breast cancer tissues of at least 25 patients assuming an appropriate level of statistical significance can be achieved. Specifically for ErbB2, a high level or positive status can also be a status that is associated with poor prognosis as determined by the various methods described in Dowsett, M., T. Cooke, et al. (2000) "Assessment of HER2 status in breast cancer: why, when and how?" Eur. J. Cancer 36(2): 170-6 and Pauletti, G., S. Dandekar, et al. (2000) "Assessment of methods for tissue-based detection of the HER-2/neu alteration in human breast cancer: a direct comparison of fluorescence in situ hybridization and immunohistochemistry" J. Clin. Oncol. 18(21): 3651-64, both of which are herein incorporated by reference in their entirety. For example, as described in Dowsett, M., T. Cooke, et al., ErbB2 gene amplification can be considered a high level or positive status for the purpose of the present invention.

[0047] In the specification, comments and hypotheses are made on theories as to how ERR.alpha., ER.alpha. and ErbB2 are involved in breast cancer. These theories are not intended to limit the invention.

[0048] In one aspect, the present invention is a method for determining breast cancer prognosis by analyzing the status of ERR.alpha. in the breast cancer tissue. As described in Example 3 below, a high level of ERR.alpha. in breast cancer tissue correlates with poor prognosis. This means that after diagnosis, breast cancer patients with high ERR.alpha. levels will likely have a shorter survival time than those with low ERR.alpha. levels.

[0049] In another aspect, the present invention is a method for categorizing breast cancer patients for treatment purposes. The method involves determining the status of ERR.alpha. either alone or in conjunction with ER.alpha., PgR and/or ErbB2 in breast cancer tissues. Generally speaking, as described in Example 2 below, ERR.alpha. acts as a repressor of ERE-dependent transcription in cells that are ER-positive (e.g., breast cancer cell line MCF-7) and an activator in cells that are ER-negative (e.g., HeLa cells and breast cancer cell line SK-BR-3 (Yang, C., et al., Cancer Res. 58:5695, 1998)). In Example 3 described below, ERR.alpha. in breast cancer cells is shown to associate with both ER-negative status and PgR-negative status. In these breast cancer cells, ERR.alpha. levels are either similar to or higher than ER.alpha. levels, while in ER-positive and PgR-positive breast cancer cells, ERR.alpha. levels are lower than ER.alpha. levels. The term "similar" used in the specification and claims refers to the levels of ER.alpha. and ERR.alpha. in a particular tumor being within a range where they can effectively compete for binding DNA, or in practical terms, within 2-fold of each other (the ratio of one to the other is from 0.5 to 2). Likewise, when the level of one is referred to as higher or lower than that of the other in this context, we mean that the level is more than 2-fold higher or lower. Thus, when breast cancer cells lack functional ER, as in the cases of ER negative (with PgR positive or negative status) and ER positive/PgR negative cancers, and, the cancer cells have high levels of ERR.alpha., ERR.alpha. in these cells is likely to act as an activator of ERE-dependent transcription. Patients with such breast cancer cells are unlikely to respond to hormonal blockade therapy such as tamoxifen therapy. Other therapies for breast cancer should be recommended. Hormonal blockade therapy includes the use of anti-estrogens, aromatase inhibitors and other agents that can block the production or activity of estrogen.

[0050] In breast cancer cells that contain functional ER, as in the cases of ER.alpha. positive and PgR positive cancers, and have low levels of ERR.alpha., ERR.alpha. is likely to act as a repressor of ERE-dependent transcription. Patients with such breast cancer cells are likely to respond to hormonal blockade therapy such as tamoxifen therapy.

[0051] When the breast cancer of a patient has an ERR.alpha. level that is similar to or higher than the ER.alpha. level, the patient is unlikely to respond to hormonal blockade therapy. Other therapies for breast cancer should be considered.

[0052] In Example 3 described below, ERR.alpha. level in breast cancer cells correlates with ErbB2 level. We hypothesize that ERR.alpha. is a downstream target of ErbB2. When the breast cancer cells of a patient have a high ErbB2 level and a high ERR.alpha. level, the patient is not likely to respond to hormonal blockade therapy but is likely to respond to ErbB2-based therapy. ErbB2-based therapy includes the use of agents that either directly inhibit ErbB2 activity (anti-ErbB2 antibodies such as Herceptin and ErbB2-specific kinase inhibitors) or indirectly inhibit ErbB2 activity through heterodimerization with other ErbB members. For instance, anti-EGFR antibodies or Irressa, an EGFR kinase inhibitor, can also block ErbB2 activity. The latter does it via the formation of EGFR-ErbB2 heterodimers. When the breast cancer cells of a patient have a high ErbB2 level and a low ERR.alpha. level, the patient is not likely to respond to ErbB2-based therapy. It is questionable whether such a patient will respond to hormonal blockade therapy and hormonal blockade therapy remains an option. However, breast cancer therapies other than ErbB2-based therapy and hormonal blockade therapy should be seriously considered as well.

[0053] In another aspect, the present invention is a method of treating breast cancer by modulating ERR.alpha. activity. As described above, ERR.alpha. modulates ERE-dependent transcription. In addition, ERR.alpha. modulates transcription of at least some genes that are estrogen responsive and/or implicated in breast cancer such as pS2 (Lu, D., et al., Cancer Res. 61: 6755-6761, 2001), aromatase (Vanacker, J. M., et al., Cell Growth Differ. 9:1007-1014, 1998.), osteopontin (Bonnelye, E., et al., Mol Endocrinol. 11:905-916, 1997; Vanacker, J. et al., Cell Growth Differ. 9:1007-1014, 1998.) and lactoferrin (Yang, N., et al., J Biol Chem. 271:5795-5804, 1996; Zhang, Z. and Teng, C. T., J Biol Chem. 275:20837-20846, 2000). Thus, ERR.alpha. likely plays important roles in at least some breast cancers by modulating or substituting for ER-dependent activities.

[0054] The method of the present invention for treating breast cancer first involves determining whether ERR.alpha. is an activator or a repressor of ERE-dependent transcription in the cancer cells of a breast cancer patient. If ERR.alpha. is an activator, the breast cancer is treated by decreasing ERR.alpha. activity in breast cancer cells. If ERR.alpha. is a repressor, the breast cancer is treated by increasing ERR.alpha. activity in breast cancer cells.

[0055] Whether ERR.alpha. is an activator or a repressor of ERE-dependent transcription can be determined depending upon the presence of functional ER or the level of ERR.alpha. relative to ER.alpha. in the breast cancer. As described above, ERR.alpha. acts as a repressor of ERE-dependent transcription in cells that are ER-positive and an activator in cells that are ER-negative. In breast cancer cells, increased ERR.alpha. levels associate with ER-negative status and PgR-negative status. In these breast cancer cells, the ERR.alpha. expression level is either similar to or higher than the ER.alpha. expression level while in ER-positive and PgR-positive breast cancer cells, the ERR.alpha. level is lower than the ER.alpha. level. Accordingly, when the ERR.alpha. level is higher than the ER.alpha. level or when the ERR.alpha. level is high in ER-negative cancer cells, ERR.alpha. acts as an activator. When ERR.alpha. level is low in a functional ER-positive cancer cells, ERR.alpha. acts as a repressor. Expression levels of ErbB2 may also be used to determine whether ERR.alpha. is an activator or repressor. In breast cancer cells, high levels of ErbB2 associated with high levels of ERR.alpha. and associated with low levels of ER.alpha.. Thus, in ErbB2-positive breast cancers, ERR.alpha. is likely an activator of transcription.

[0056] In addition, whether ERR.alpha. is an activator or a repressor of ERE-dependent transcription can be determined by reporter gene assays. An ERE-based reporter plasmid can be divered in the absence and presence of an ERR.alpha. expression plasmid into the breast cancer cells of a patient and the reporter gene's expression level can be measured. Decreased or increased levels of the reporter gene (or an ERR.alpha. target gene) in the presence of the ERR.alpha. expression plasmid relative to its absence would indicate that ERR.alpha. is a repressor or activator of ERE-dependent transcription, respectively. The breast cancer cells can be biopsied from the patient and transfected with the DNA plasmid ex vivo. An example of the reporter gene assays is described in the Example 2 below.

[0057] Other methods known in the art can also be used to determine whether ERR.alpha. is an activator or a repressor of ERE-dependent transcription.

[0058] The ERR.alpha. activity in breast cancer cells can be modulated by modulating ERR.alpha. protein levels in the cells. For example, an antisense oligonucleotide can be used to inhibit the expression of ERR.alpha.. Other agents that can modulate ERR.alpha. expression can be identified by exposing a goupe of cells that express ERR.alpha. to a test agent and compairing the ERR.alpha. expression in these cells at the mRNA level or at the protein level to control cells that are not exposed to the agent. ERR.alpha. expression can also be measured indirectly by using reporter plasmids whose expression is altered by ERR.alpha..

[0059] In addition, the ERR.alpha. activity in breast cancer cells can be modulated via gene therapy by introduction of exogenous variant ERR.alpha. proteins with altered activities (dominant-negative ERR.alpha.). In Example 2 below, a mutant form of ERR.alpha. incabable of activating transcription (ERR.alpha.1.sub.L413a/L418A) was transfected into MCF-7 cells and repressed ERE-dependent transcription better than wild-type ERR.alpha.. Therefore, such a mutant ERR.alpha. can be used to specifically inhibit endogenous ERR.alpha. transcriptional activity as well as ER-mediated ERE-dependent activity.

[0060] One can also use an ERR.alpha. agonist or antagonist to modulate ERR.alpha. activity. The synthetic estrogen diethylstilbestrol is an ERR.alpha. antagonist. Other ERR.alpha. agonists or antagonists can be screened by exposing ERR.alpha. to a test agent and determining whether the test agent binds to ERR.alpha.. There are many ways that this can be done. For example, a test agent can be labeled and ERR.alpha. can be exposed to the test agent, washed and purified. If the label is detected on the purified ERR.alpha., then the test agent has bound to ERR.alpha.. Once a test agent is determined to be capable of binding to ERR.alpha., whether the agent can activate or inhibit ERR.alpha. activity can be determined. For example, a reporter for ERR.alpha. activity can be introduced into host cells along with an ERR.alpha. expression plasmid. The cells can then be exposed to the test agent and the ERR.alpha. activity in these cells can be compared to that of control cells that are not exposed to the agent. As an example, a system for analyzing ERR.alpha. activity as a regulator of ERE-dependent transcription, either as a repressor or activator, is described in Example 2 below.

[0061] In a more general manner, cells that carry a reporter for ERR.alpha. activity can be used directly to screen for agents that can modulate ERR.alpha. activity by exposing the cells to a test agent and comparing the ERR.alpha. activity in these cells to control cells that are not exposed to the agent.

[0062] ERR.alpha. activity can also be inhibited by an ERR.alpha. antibody (either monoclonal or polyclonal), which can be readily generated by a skilled artisan. Encapsulating liposomes or other similar technology can be used to deliver anti-ERR.alpha. antibodies into cells. Alternatively, recombinant DNAs expressing an anti-ERR.alpha. antibody (such as in the form of a single-chain antibody fragment) can be introduced into cells via gene therapy methodologies.

[0063] In another aspect, the present invention is a method of identifying human candidates for further breast cancer examination by screening for mutations in ERR.alpha. against a reference ERR.alpha. sequence or by screening for an aberrantly spliced mRNA variant of ERR.alpha.. For example, the National Center for Biotechnology Information (NCBI) Reference Sequence entry for ERR.alpha., NM.sub.13 004451, can serve as a reference ERR.alpha. sequence. As mentioned above, ERR.alpha. likely plays important roles in human breast cancer. A mutation in ERR.alpha. or the existence of an aberrantly spliced mRNA variant of ERR.alpha. may predispose a human being to breast cancer. Accordingly, an individual who carries a mutated ERR.alpha. or an aberrantly spliced mRNA variant of ERR.alpha. should be monitored closely for breast cancer development.

[0064] The invention will be more fully understood upon consideration of the following non-limiting examples.

EXAMPLE 1

[0065] We (see Johnston, S. D., Ph.D. Thesis, Activation and repression of the SV40 late promoter, University of Wisconsin-Madison, 1996; Johnston, S. D., et al., supra, 1997, see below) and others (Yang, N., et al., J. Biol. Chem. 271-5795-5804, 1996) have found that a 53-kD protein, called ERR.alpha.1, is a major isoform expressed in vivo from the ERR.alpha. gene. Using this biologically relevant, non-chimeric, recombinant human ERR.alpha.1 protein, we demonstrate here that ERR.alpha. protein can, indeed, bind with high-affinity the DNA binding site containing 5'-TCAAGGTCA-3'. We also report the development of in vitro and in vivo functional assays for ERR.alpha. activity. Lastly, binding sites for ERR.alpha. are identified in cellular promoters, some of which contain functional estrogen-response elements (EREs) and exhibit altered expression in some breast cancers, and ERR.alpha. is shown to bind directly ER.alpha.. We predict that ERR.alpha. can play roles in the response of some genes to estrogen via protein-protein interactions with ER or competition with ER for binding to EREs and regulating transcription.

[0066] Materials and Methods

[0067] Oligonucleotides and recombinant plasmids: Oligonucleotides were synthesized by Integrated DNA Technologies (Coralville, Iowa) or GIBCO BRL Life Technologies (Gaithersburg, Md.). Complementary strands were annealed by heating to 95.degree. C. for 5 minutes and cooling to room temperature over 2 hours. Annealed oligonucleotides were purified with a non-denaturing 15% polyacrylamide gel (Sambrook, J., et al., Molecular cloning: A laboratory manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989). Plasmid pRSV-ER-hERR.alpha. directs the expression of a fusion protein consisting of the first 44 amino acids of ER.alpha. and all but the first 38 amino acid residues of the previously published ERR.alpha. sequence constructed from putatively overlapping cDNA clones (Zuo, F., and Mertz, J. E., supra, 1995). "Full-length" ERR.alpha. cDNA was RT-PCR-amplified out of HeLa cell mRNA and inserted in the KpnI-to-HindIII sites of pSP72 (Promega) to generate pSP72-hERR.alpha.. Plasmid pSP72-hERR.alpha.1 was generated by PCR-amplification of a portion of the "full-length" ERR.alpha. coding sequence (using the 5' primer AGCGCCATGGCCAGCCAGGTGGTGGGCATT (SEQ ID NO:1), with the translation start codon for ERR.alpha.1 (underlined) and ligation back into NcoI- and XmaI-cut pSP72-hERR.alpha.. Plasmid pGEX-hERR.alpha.1 was constructed similarly. The plasmids directing the expression of GST COUP-TF1 and GST-.beta.globin1-123 have been described previously (Johnston, S. D., et al., J. Virol. 70:1191-1202, 1996). The NaeI fragment of the ERR.alpha. cDNA was cloned into a pGEX-2T vector (Pharmacia) to generate pGEX-hERR.alpha.1.sub.17-329 The plasmid pGEX-ER was constructed by subcloning the ER.alpha.-encoding EcoRI fragment of pHEGO, a gift of P. Chambon (Tora, L., et al., EMBO J. 8:1981-1986, 1989), into pGEX. Plasmids pGEX-TFIIB and phIIB (Ha, I., et al., Nature 352:689-695, 1991) were gifts from D. Reinberg. Plasmid pRSV-hERR.alpha.1 was generated by subcloning the sequences coding for ERR.alpha.1 from pGEX-hERR.alpha.1 into pRSV-0+, a derivative of pRSV-0 (Zuo, F., and Mertz, J. E., supra, 1995) containing a functional SV40 origin of DNA replication.

[0068] Cell culture and transfections: CV-1PD cells and COS cells were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 5% and 10% fetal bovine serum (FBS), respectively. HeLa S3 cells were grown in RPMI-1640 with 2 mM glutamine and 10% FBS. All media were supplemented with penicillin and streptomycin. Co-transfections were performed by a modification of the DEAE-dextran/chloroquine procedure as described (Good, P. J., et al., J. Virol. 62:563-571, 1988) or the calcium phosphate co-precipitation method. SV40 viral sequences were excised from the plasmid-cloning vector and ligated to form monomer circles before transfection.

[0069] Recombinant proteins and antiserum: Recombinant GST-fusion proteins were purified essentially as described (Johnston, S. D., et al., supra, 1996). HeLa cell nuclear extract was prepared as previously described (Wiley, S. R., et al., supra, 1993; Dignam, J. D., et al., Methods Enzymol. 101:582-598, 1983). In vitro transcribed and translated ("TNT") proteins were synthesized with a rabbit reticulocyte lysate (Promega) and [.sup.35S]-methionine and cysteine (Tran.sup.35S Label; ICN) following the manufacturer's suggested protocol. Recombinant ER.alpha. and ERR.alpha.1 were synthesized in COS cells transfected with plasmids encoding these proteins. A polyclonal antiserum was raised in a New Zealand white rabbit against GST-ERR.alpha.1.sub.17-329. Molecular mass determination was performed with Combithek (Boehringer Mannheim) and Mark 12 (Novex) calibration proteins as standards.

[0070] Metabolic labeling and immunoprecipitation: Cells were metabolically labeled when approximately 80% confluent by incubation for 4 hours with medium containing [.sup.35S]-methionine and -cysteine (250 mCi Tran.sup.35S Label; ICN) as described (Johnston, S. D., supra, 1996). Protein lysates were prepared (Johnston, S. D., supra, 1996) and were pre-cleared by incubation for 1 hour with protein A-agarose (Santa Cruz Biotech). The resulting supernatant was incubated for 1 hour on ice with 1 ml of anti-GST-ERR.alpha.1.sub.17-329 serum or pre-immune serum from the same animal. Afterward, protein A-agarose was added and the lysate was incubated for 1 hour at 4.degree. C. The beads were washed three times and the proteins were eluted by boiling in 2.times.SDS loading buffer. The radiolabeled proteins were separated in a 10% SDS-PAGE gel and detected by fluorography.

[0071] S1 nuclease mapping and primer extension analysis: Total cellular RNA was prepared by lysis of the cells in SDS and treatment with Proteinase K. Nucleic acids were extracted and DNA was degraded by treatment with DNase I (Zuo, F., supra, 1995). Poly(A)+ HeLa S3 RNA was prepared with an mRNA Separator kit (Clontech). The S1 nuclease mapping probe consisted of the PvuII-to-HpaI fragment of pSP72-hERR.alpha. (FIG. 1); it was gel-purified and end-labeled with [.gamma.-.sup.32P]ATP using T4 polynucleotide kinase (Ausubel, F. M., et al., "Current Protocols in Molecular Biology," John Wiley and Sons, Inc, New York, N.Y., 1994). The hybridization and S1 nuclease digestion reactions were performed essentially as described (Hertz, G., and Mertz, J. E., Virology 163:579-590, 1988). The resulting protected fragments were separated by electrophoresis through a 7M urea, 5% polyacrylamide gel.

[0072] Primer extension analyses were performed essentially as described (Good, P. J., et al., supra, 1988) using the 5'-end labeled oligonucleotide 5'-GCGTCTAGAGATGTAGAGAGGCTCAATGCCCACCACC-3' (SEQ ID NO:2) as primer (FIG. 1). The resulting DNAs were resolved in a 7 M urea, 8% polyacrylamide gel.

[0073] Quantitative gel-mobility-shift assays: DNA binding was assayed in 20 .mu.l of a buffer containing 10 mM HEPES (pH 7.5), 2.5 mM MgCl.sub.2, 50 .mu.M EDTA, 1 mM dithiothreitol, 6% glycerol and 100 ng/.mu.l of poly(dI-dC).multidot.poly(dI-dC). Competition binding assays included unlabeled competitor oligonucleotide as well. 250 pg of 5'-end-labeled, double-stranded oligonucleotide (approximately 5.times.10.sup.4 cpm) was incubated with approximately 0.85 ng of GST-ERR.alpha.1 or GST-.beta.globin1-123. Supershift assays contained 1 .mu.l of a 1:10 dilution of whole antiserum. All components were mixed prior to the addition of protein. The final mixtures were incubated on ice for 15 minutes, followed by 25.degree. C. for 15 minutes prior to separation by electrophoresis at 4.degree. C. for 2 hours through a non-denaturing 4% polyacrylamide gel at 160 volts. Quantitation was performed with a PhosphorImager (Molecular Dynamics). The relative affinities of different sequences for binding by the protein were determined from the moles of unlabeled competitor oligonucleotide needed to reduce the fraction of probe shifted to 50%.

[0074] For assays involving ER.alpha., 1-2 .mu.l of whole cell extract containing ER.alpha. (500-700 ng protein) were incubated on ice for 15 minutes in a reaction mixture containing 20 mM HEPES (pH 7.4), 1 mM DTT, 100 mM NaCl, 10% glycerol (v/v), 100 .mu.g/ml BSA, 4 .mu.g poly(dI-dC).multidot.(dI-dC) in 16 .mu.l. Radiolabeled probe DNA (20,000-50,000 cpm, 0.2-0.5 ng) was added and incubated for 20 minutes at room temperature. The samples were loaded directly on a pre-run 4% acrylamide (39:1 acrylamide/bis-acrylamide) non-denaturing gel with 0.5.times.TBE as the running buffer. The gels were run in the cold room for 2 hours at 180 V and dried onto filter paper.

[0075] Footprinting: The probes used in the DNase I footprinting assays were PCR-amplified DNA corresponding to SV40 nt 272-446. Sense and anti-sense probes were created by 5'-end-labeling one of the PCR primers. The PCR products were gel-purified before use. Approximately 30 ng of GST-ERR.alpha.1 was incubated 20 minutes at room temperature with 3-5.times.10.sup.5 cpm of the probe in 50 mM HEPES (pH 7.6), 6 mM MgCl.sub.2, 500 .mu.M EDTA, 20% glycerol, 8% polyethylene glycol and 0.1 mg/ml poly(dI-dC).multidot.poly(dI-dC). One .mu.l of a 1:50 dilution of DNase I was added and the incubation was continued for 1 minute. The reactions were electrophoresed through a non-denaturing 4% polyacrylamide gel. The protein-DNA complexes and unbound DNA were visualized by autoradiography and excised and eluted from the gel. The DNAs were purified by phenol:chloroform extraction and ethanol precipitation. Equal counts from the unbound and bound complexes were loaded onto a 7M urea, 6% denaturing polyacrylamide gel. After electrophoresis, the gel was dried and exposed to x-ray film.

[0076] Hydroxyl radical footprinting was performed essentially as described by Tullius and Dombroski (Tullius, T. D., and Dombroski, B. A., Proc. Natl. Acad. Sci. USA 83:5469-5473, 1986). The probes were synthesized by PCR-amplification from an SV40 mutant, pm322C, containing an ERR.alpha. binding site only at +55 (Wiley, S. R., et al., supra, 1993). Approximately 1.times.10.sup.7 cpm of this probe was cleaved prior to use in the footprinting reactions. Thereafter, the DNAs were treated essentially as described above.

[0077] Cell-free transcription: Cell-free transcription assays were performed as described (Wiley, S. R., et al., supra, 1993; Zuo, F., and Mertz, J. E., supra, 1995). In brief, 200 ng of circular, plasmid SV40 DNA as template was incubated for 15 minutes at 4.degree. C. with approximately 37 ng of the indicated fusion protein, followed by 15 minutes at 25.degree. C. before addition of the nuclear extract. The resulting SV40 transcripts were analyzed by primer extension (Zuo, F., and Mertz, J. E., supra, 1995; Good, P. J., et al., supra, 1988) with synthetic oligonucleotides corresponding to SV40 nt 5178-5201 and nt 446-422 serving as primers for the detection of the early and late RNAs, respectively.

[0078] Binding assays: Protein-protein associations were assayed essentially as described (Johnston, S. D., et al., supra, 1996). Briefly, bacterial lysate containing approximately 4 pmol of the GST fusion protein was thawed on ice and mixed with GSH-Sepharose at 4.degree. C. for at least 30 minutes. The beads were washed twice at 4.degree. C. with 500 .mu.l NETN buffer, resuspended in 50 .mu.l NETN buffer, mixed at 4.degree. C. for at least 1 hour with the test protein (typically in 0.2-2 .mu.l of reticulocyte lysate), and washed three times at 4.degree. C. with NETN buffer. The bound proteins were eluted from the beads by boiling in SDS loading buffer and resolved by SDS-PAGE. For the experiment shown in FIG. 9B, the lysates were treated with 50 mg/ml ethidium bromide before use in this binding assay as described (Lai, J.-S., and Herr, W., supra, 1992). The gels were stained with Coomassie brilliant blue, destained, equilibrated in water and treated with 1M salicylic acid for 30 minutes before being dried and exposed to x-ray film.

[0079] Results

[0080] Human ERR.alpha.1: The original sequence of human ERR.alpha. cDNA was deduced from putatively overlapping cDNA clones (Gigure, V., et al., supra, 1988). It encodes a 521-amino acid protein with an apparent molecular mass of 63 kDa by SDS-PAGE (Johnston, S. D., supra, 1996). We failed by pulse-labeling/immunoprecipitation and immunoblotting techniques to find a protein of this size in any of numerous natural sources that cross-reacted with our human ERR.alpha.-specific antiserum; instead, we identified a faster-migrating protein (Johnston, S. D., supra, 1996; see below). We hypothesized that this naturally existing protein is an isoform encoded by the ERR.alpha. gene in which translation initiates at the second methionine codon, corresponding to amino acid residue 98 in the published sequence (see FIG. 1). This product of the human ERR.alpha. gene is named ERR.alpha.1.

[0081] FIG. 1A is a schematic diagram of human ERR.alpha.1. Human ERR.alpha.1 is the same as human ERR1 described by Gigure, et al. (Gigure, V., et al., supra, 1988), except for lacking the first 97 amino acids and having corrections in the amino acid sequence from the one originally reported (Yang, N., et al., supra, 1996 reports the corrected sequence. Yang, et al. is incorporated by reference as if fully set forth herein). The positions of the DNA binding domain (DBD) and ligand binding domain (LBD) are indicated, as are the percentages of amino acid identity between human ERR.alpha.1 and human ER.alpha. for each of these domains. Structures of the probes used in the experiments presented in FIG. 3 are shown at the bottom; the 5'-ends correspond to the regions encoding the amino acid residues of ERR.alpha.1 and the wavy line indicates sequences discontinuous with the ERR.alpha. cDNA.

[0082] To test this hypothesis, a polyclonal antiserum against amino acid residues 17-329 of ERR.alpha.1 was used in immunoblotting experiments to compare the ERR.alpha. proteins present in a HeLa cell nuclear extract with ERR.alpha.1 produced by in vitro transcription and translation in a rabbit reticulocyte lysate ("TNT").

[0083] FIG. 2 demonstrates the size of human ERR.alpha.1 in human cells. FIG. 2(A) represents proteins present in a HeLa cell nuclear extract (lane 3) and synthesized from a human ERR.alpha.1 cDNA clone by in vitro transcription and translation ("TNT") (lane 2) that were detected by immunoblotting with an antiserum directed against GST-ERR.alpha.1.sub.117- -329. The TNT control (lane 1) was unprogrammed reticulocyte lysate. FIG. 2(B) represents HeLa cells that were metabolically labeled with [.sup.35S]-methionine and -cysteine for 4 hours before being washed and lysed. Radiolabeled proteins were immunoprecipitated with a pre-immune serum (lane 1) or a GST-ERR.alpha.1.sub.117-329 antiserum (lane 2) and detected by fluorography. The molecular mass markers used here had been conjugated to a colored moiety and, thus, were not precise determinants of molecular mass.

[0084] The predominant protein found in each sample co-migrated (FIG. 2A). Careful measurements of its mobility indicated that its apparent molecular mass is 53 kDa (data not shown). A second, less abundant, 58-kDa protein that reacted with our antiserum was also observed in variable quantities in some preparations of HeLa cell nuclear extract (data not shown).

[0085] The sizes of the in vivo-synthesized human ERR.alpha.1 proteins were also determined by metabolic labeling of HeLa cells with [.sup.35S] methionine and cysteine, followed by immunoprecipitation. Again, a 53-kDa protein was identified (FIG. 2B); no larger protein was ever observed. This 53 kDa protein was also observed in eight other mammalian cell lines derived from a variety of tissues (CV-1PD, MCF7, T47D, Hs1, Hs181, RL95-2, HepG2, and .alpha.E6/E7-2) (Johnston, S. D., supra, 1996) and was found to have a half-life of 10-12 hours (Johnston, S. D., supra, 1996). Thus, we conclude that ERR.alpha.1 corresponds to the authentic, major isoform synthesized from the ERR.alpha. gene in vivo.

[0086] To confirm this finding, we also analyzed the location of the 5'-ends of endogenous ERR.alpha. mRNAs present in human HeLa cells by S1 nuclease mapping with the probe shown in FIG. 1. FIG. 3 is a photograph of an electrophoretic gel displaying the major species of ERR.alpha. mRNA present in HeLa cells encodes ERR.alpha.1, not "full-length" ERR.alpha.. FIG. 3(A) depicts S1 nuclease mapping analysis of ERR.alpha. mRNAs. The structures of the 5'-ends of the ERR.alpha. mRNAs accumulated in HeLa cells were analyzed by S1 nuclease mapping with the probe shown in FIG. 1A. The reaction mixtures contained no RNA (lane 1), 9 .mu.g whole cell RNA (lane 2), 54 .mu.g whole cell RNA (lane 3), 0.6 .mu.g poly (A)+ RNA (lane 4), or 5.8 .mu.g poly (A)+ RNA (lane 5). M, MspI-cut pBR322 DNA. FIG. 3(B) depicts primer extension analysis of human ERR.alpha. mRNA. A synthetic oligonucleotide, 5'-end-labeled 48 nt 3' of the ERR.alpha.1 initiation codon, was hybridized with the RNA and extended with AMV reverse transcriptase. The products were resolved by denaturing polyacrylamide gel electrophoresis and visualized by autoradiography. Samples contained either 12 .mu.g whole cell RNA (lane 1), 60 .mu.g whole cell RNA (lane 2), 3.6 .mu.g poly (A)+ RNA (lane 3), 18 .mu.g poly (A)+ RNA (lane 4), or no RNA (lane 5). M, MspI-cut pBR322 DNA.

[0087] Whereas RNA that could encode "full-length" ERR.alpha. would be expected to protect 634 nt of this probe, we observed a protected fragment only 510 nt in length (FIG. 3A). Thus, most of the ERR.alpha. mRNA accumulated in HeLa cells was discontinuous with the deduced ERR.alpha. sequence described by Gigure, et al. (Gigure, V., et al., supra, 1988) at approximately nt +180 relative to the AUG codon presumed to be used for the synthesis of "full-length" ERR.alpha..

[0088] To determine whether this discontinuity corresponded to the true 5'-end of the mRNA or a splice site, we also examined the structure of the 5'-end of the RNA by primer extension analysis using a primer that could hybridize to the RNA just 3' of the AUG codon presumed to be used for the synthesis of ERR.alpha.1 (FIG. 1): two major bands, 223 and 266 nt in length, were observed (FIG. 3B). The 223-nt band corresponded well with the major 5'-end identified by S1 nuclease mapping. It also corresponded to the 5'-end of a ERR.alpha.1 cDNA isolated by Yang, et al. (Yang, N., et al., supra, 1996) from a human endometrium carcinoma cell line. Thus, it is highly likely that this is the location of the 5'-end of the major species of ERR.alpha. mRNA that accumulates in at least some human cell lines. Because the first AUG codon in this mRNA is the codon present at the amino-terminus of ERR.alpha.1, this mRNA likely encodes ERR.alpha.1 protein, but cannot encode "full-length" ERR.alpha.. The minor, 266-nt band observed by primer extension analysis also cannot correspond to an mRNA encoding "full-length" ERR.alpha.. Thus, we conclude that the major, ERR.alpha.-encoded protein which accumulates in HeLa cells is probably identical in primary structure to the ERR.alpha.1 protein depicted in FIG. 1A. However, other isoforms synthesized from the human ERR.alpha. gene may also exist in minor quantities (e.g. ERR.alpha.2; see FIG. 1B) or in different tissues or times during development.

[0089] DNA binding by ERR.alpha.: Because ERR.alpha. was initially cloned on the basis of amino acid similarity with ER.alpha., the DNA sequence(s) it binds was unknown. We, therefore, investigated the DNA binding properties of ERR.alpha.. Since Wilson, et al. (Wilson, T. E., et al., supra, 1993) hypothesized that ERR.alpha. might bind a DNA sequence similar to the one bound by SF-1, we first looked for binding by a gel-mobility-shift assay with a probe consisting of a double-stranded synthetic oligonucleotide containing the high-affinity SF-1 binding site sequence, 5'-TCAAGGTCA-3'. FIG. 4 is a photograph of gel-mobility-shift assays showing sequence-specific binding of recombinant human ERR.alpha.1 protein. Bacterially expressed GST-.beta.globin.sub.1-123 (lane 1) and GST-ERR.alpha.1 (lanes 2-13) were incubated with radioactive, double-stranded SF-1 oligonucleotide as a probe. A pre-immune (lane 3) or polyclonal anti-GST-ERR.alpha.1.sub.17-329 (lane 4) serum was added to some of the binding reactions before the addition of recombinant protein. Lanes 5-13 show quantitative, competition gel-mobility-shift assays in which the indicated molar fold excesses of the indicated unlabeled, double-stranded oligonucleotides were included in the reactions as competitors. The sequences of one strand of each of these oligonucleotides are shown in FIG. 5.

[0090] GST-ERR.alpha.1 was, indeed, found to bind this SF-1 probe (FIG. 4, lane 2). Incubation with our polyclonal anti-ERR.alpha. serum resulted in both the supershifting of a portion of this ERR.alpha.-DNA complex and the prevention of the formation of another portion of it (FIG. 4, lane 4 vs. 3). Thus, we conclude that ERR.alpha. binds specifically to the high-affinity binding site of SF-1.

[0091] To better understand the range of DNA sequences recognized by ERR.alpha., we tested the ability of ERR.alpha. to bind to sequences from a variety of promoters, including many hormone response elements (HREs). Because prior work from our laboratory indicated that ERR.alpha. probably binds to two sites in the SV40-MLP, the +1 and +55 sites (Wiley, S. R., et al., supra, 1993; Zuo, F., and Mertz, J. E., supra, 1995), we tested the affinity of ERR.alpha. for these sites relative to the SF-1 site using a quantitative, competition gel-mobility-shift assay (FIG. 4, lanes 5-13): an oligonucleotide corresponding to the +55 site of the wild-type (WT) SV40-MLP competed moderately well (lanes 5-7); one corresponding to a mutant that binds IBP-s better that WT competed very well (lanes 11-13); and one corresponding to a mutant that fails to bind IBP-s did not compete (lanes 8-10) (summarized in FIG. 5).

[0092] Multiple sequences from a variety of cellular promoters were tested likewise (Johnston, S. D., supra, 1996; data not shown), including ones known to function as EREs since the DBDs of ERR.alpha. and ER.alpha. have 70amino acid identity (Gigure, V., et al., supra, 1988; Yang, N., et al., supra, 1996). These data are summarized in FIG. 5. FIG. 5 tabulates relative affinities of ERR.alpha. for DNA sequences from a variety of cellular and viral promoters. Quantitative, competition gel-mobility-shift assays were performed as described in the legend to FIG. 4 with double-stranded oligonucleotides corresponding to the sequences shown in the third column of the table serving as the unlabeled competitors. The fourth column indicates the affinities of ERR.alpha. for the competitor sequences relative to the SF-1 probe; these values were determined experimentally from the fold molar excess of competitor oligonucleotide needed to reduce by 50% the fraction of probe shifted. The second column indicates the cases in which these sequences are known from the scientific literature to contain functional estrogen-response elements. N.d.=not determined. The complete sequence of the lactoferrin oligonucleotide is reported as the FP1 sequence in Yang, et al. (Yang, N., et al., supra, 1996).

[0093] Some of the EREs tested (e.g., prolactin D, vitellogenin) did, indeed, bind ERR.alpha. with moderately high relative affinities (see also below). Thus, some EREs contain binding sites for ERR.alpha..

[0094] By comparing the sequences that bound ERR.alpha. well with those that bound it poorly or not at all, we deduced that a high-affinity, consensus DNA-binding site for ERR.alpha. is 5' TCAAGGTCA-3'. However, some of the oligonucleotides containing this consensus sequence (e.g., P450 scc) did not bind ERR.alpha. well; thus, bases beyond the 9-bp consensus sequence also affect the binding affinity.

[0095] ERR.alpha. binds extended hormone response element (HRE) half-sites. Footprinting assays were performed of GST-ERR.alpha.1 bound to the major late promoter region of wild-type SV40 DNA. Consistent with the data summarized in FIG. 5, GST-ERR.alpha.1 was found to strongly protect from digestion by DNase I the +1 and +55 sites present in the SV40-MLP (FIG. 6A). FIG. 6 demonstrates that ERR.alpha. binds the extended HRE half-site sequences present in the SV40-MLP. FIG. 6(A): Autoradiograms of DNase I footprints of GST-ERR.alpha.1 bound to the +1 and +55 sites of the SV40-MLP. Outermost lanes, no protein; interior lanes, GST-ERR.alpha.1. FIG. 6(B): Autoradiograms of hydroxyl radical footprints of GST-ERR.alpha.1 bound to the +55 site of the SV40-MLP in isolation from other ERR.alpha.-binding sites. FIG. 6(C): Summary of the nucleotides of the SV40-MLP protected by ERR.alpha. as determined from the data in panels A and B. The thick and thin solid bars indicate complete and partial protection, respectively, from digestion with DNase I. The stippled bars indicate nucleotides in the +55 site necessary for binding by ERR.alpha. as determined by the hydroxyl radical footprint analysis. The boxed bases are the core half-site sequences present in the +1 and +55 sites (Wiley, S. R., et al., supra, 1993).

[0096] Within each of these protected regions are two half-site sequences, either or both of which could potentially be recognized by ERR.alpha.. The exact bases protected were determined by comparison with dideoxy sequencing reactions of the probe DNA that were co-electrophoresed next to the footprinting reactions (data not shown) (summarized in FIG. 6C, solid bars). At each site, only one of the two half-sites was covered by ERR.alpha.. Therefore, ERR.alpha.1 can bind to a single half-site sequence.

[0097] Higher resolution mapping of the ERR.alpha. binding site was done using a hydroxyl radical footprinting technique with a probe made from an SV40 mutant, pm322C, which is defective in the +1 site (Wiley, S. R., et al., supra, 1993) and, thus, contains only the +55 site. As is shown in FIG. 6B (summarized in FIG. 6C, stippled bars), the nucleotides within and directly adjacent to only one of the two +55 site half site sequences present in the probe DNA were necessary for the binding of GST-ERR.alpha.1. Footprint analyses with probe DNAs containing mutations in the unprotected half-site sequences present in the +1 and +55 regions of the SV40-MLP (Wiley, S. R., et al., supra, 1993; data not shown) confirmed that these unprotected half-site sequences do not contribute to the binding of ERR.alpha... Thus, we conclude that ERRU can bind to extended half-site sequences.

[0098] ERR.alpha. sequence-specifically inhibits transcription from the SV40 late promoter: Previous data indicated that a component(s) of IBP-s sequence-specifically repressed transcription from the SV40-MLP in a cell-free system made from HeLa cell nuclear extract (Wiley, S. R., et al., supra, 1993). To confirm that ERR.alpha. has this biochemical activity, this assay was repeated with recombinant ERR.alpha.1 protein (FIG. 7). FIG. 7 is a photograph of GST-ERR.alpha.1 sequence-specifically repressing transcription from the SV40-MLP and minor late promoters in a cell-free system. Approximately 37 ng of purified GST-.beta.globin (lanes 2 and 4) or GST-ERR.alpha.1 (lanes 3 and 5) were incubated with wild-type SV40 DNA or a double mutant defective in binding of ERR.alpha. to both the +1 and +55 sites of the SV40 genome (see FIG. 5 for wild-type and mutant sequences and relative binding affinities). A HeLa cell nuclear extract was used to transcribe both the early and late promoters of SV40 present on the same template DNA. Transcripts were detected by primer extension and quantified with a PhosphorImager (Molecular Dynamics).

[0099] Addition of GST-ERR.alpha.1 reproducibly decreased transcription approximately 3-fold from the wild-type SV40-MLP, but had no effect on transcription from the SV40 early promoter present on the same template DNA (FIG. 7, lane 3 vs. 1 and 2). Transcription from the minor late promoters was also inhibited. When the template contained point mutations in the +1 and +55 ERR.alpha. binding sites of SV40, the basal level of transcription from the SV40-MLP and minor late promoters increased as a result of the relief from repression by members of the superfamily present in the HeLa cell nuclear extract. Transcription was also not significantly affected by the addition of GST-ERR.alpha.1 (FIG. 7, lanes 4 and 5). These data indicate clearly and definitively that ERR.alpha. can, indeed, repress transcription from the SV40-MLP in vitro in a site-and sequence-specific manner. Furthermore, the fact that the SV40 early promoter present in the same reactions was unaffected by ERR.alpha. indicates that the repression was not a trivial consequence of squelching--e.g., the binding of a limiting amount of the transcription factor TFIIB.

[0100] Zuo and Mertz previously reported that an ER.alpha.-ERR.alpha. chimeric protein can repress transcription from the SV40-MLP in vivo. They also showed that either COUP-TF1 or TR.alpha.1/RXR.alpha. can repress transcription from the SV40 late promoter at early times during the lytic cycle of infection of CV-1 cells when viral DNA template copy number is low, but not at late times when viral DNA template copy number is high. To show definitively that this repression activity can also be encoded by ERR.alpha., CV-1P cells were co-transfected with wild-type SV40 and pRSV-ERR.alpha.1, a plasmid encoding wild-type ERR.alpha.1 and containing and SV40 origin of replication (FIG. 8, lanes 2, 4, and 6). As a control, cells were transfected in parallel with wild-type SV40 and pRSV-0.sup.+, the empty vector of pRSV-hERR.alpha.1 (FIG. 8, lanes 1, 3, and 5).

[0101] FIG. 8 is a radiographic image of an electrophoretic gel demonstrating the ERR.alpha. represses transcription from the SV40 late promoter in vivo. CV-1P cells were cotransfected with wild-type SV40 DNA (1.2 .mu.g per 10-cm dish) and 0.5 .mu.g pRSV-hERR.alpha.1, an expression plasmid encoding ERR.alpha.1 (lanes 2, 4, and 6), or pRSV-0.sup.+, its empty parental plasmid (lanes 1, 3, and 5). The cells were incubated at 37.degree. C. for the indicated times after transfection. Afterward, whole-cell RNA was purified and analyzed by quantitative S1 nuclease mapping with the SV40-specific probe described previously. The relative amounts of SV40 major late (ML) RNA accumulated in the cells were quantified with a PhosphorImager.TM. and internally normalized to the amounts of SV40 early (E-E) RNA present in the same samples. The numbers at the bottom indicate the ratios of SV40 major late-to-early RNA accumulated by the indicated times post transfection in the presence vs. absence of the ERR.alpha.1-expressing plasmid; these data are means from two experiments similar to the one shown here and varied by at most 20%. Lanes 1 and 2, 3 and 4, and 5-7 contained RNA from one-fifth, one-tenth, and one-twentieth of a 10 cm dish of cells, respectively. The arrows indicate the DNAs protected by each of the indicated viral RNA species, with L-E RNAs being SV40-specific RNAs synthesized from the early promoter only at late times after transfection. The exposure time for lanes 1 and 2 was 3-fold longer than for lanes 3-7.

[0102] As expected, overexpression of ERR.alpha. resulted in a decreased rate of accumulation of the SV40 late, but not early mRNAs until late times after transfection (e.g., 48 hours), a time at which the exogenous as well as endogenous ERR.alpha. and other IBP-s have been titrated out as a consequence of viral DNA replication to high template copy number. Therefore, we conclude that ERR.alpha. can, indeed, repress transcription from the SV40-MLP both in vitro and in vivo in a sequence-specific manner by binding to extended half-site sequences present in the DNA.

[0103] ERR.alpha. interactions: Many members of the steroid/thyroid hormone receptor superfamily are known to associate functionally with TFIIB (reviewed in ref. Tsai M.-J., and O'Malley, B. W., Annu. Rev. Biochem. 63:451-486, 1994). Therefore, we sought evidence for a similar protein interaction of ERR.alpha. with TFIIB. Fusion proteins bound to glutathione-Sepharose were incubated with [.sup.35S]-labeled proteins synthesized in a rabbit reticulocyte lysate. The affinity resin was washed and specifically retained proteins were eluted by denaturation, resolved by SDS PAGE, and detected by fluorography. In this in vitro system, TFIIB was retained by GST ERR.alpha.1 as well as it was retained by GST-COUP-TF1 or GST-ER.alpha. (FIG. 9A, lanes 1-4). FIG. 9 is a photograph of an electrophoretic gel demonstrating that ERR.alpha. associates in vitro with TFIIB and ER.alpha.. The indicated GST-fusion protein was bound to glutathione-Sepharose and incubated with [.sup.35S]-labeled protein produced by in vitro transcription and translation in a rabbit reticulocyte lysate. After washing, retained proteins were eluted by denaturation and separated by SDS-PAGE. The resulting fluorograms are shown here. In lanes 6-9 of panel B, the crude bacterial lysates and the in vitro translation mixtures were pre-incubated with ethidium bromide (50 .mu.g/ml) to disrupt protein-DNA associations and cleared by centrifugation before being used in the binding assays. Lanes 5 and 9 of panels A and B were loaded with 10% of the indicated proteins added to the binding reactions.

[0104] In a reciprocal experiment, labeled ERR.alpha.1 was specifically retained by GST-TFIIB (FIG. 9A, lanes 6 vs. 8). To eliminate the possibility that these interactions were mediated by a third protein present in the reticulocyte lysate, this experiment was also performed with proteins synthesized solely in E. coli and assayed by immunoblotting: once again, recombinant TFIIB was efficiently retained by GST-ERR.alpha.1 (Johnston, S. D., supra, 1996). Thus, we conclude that TFIIB directly associates with ERR.alpha. in vitro even in the absence of eukaryotic-specific post-translational modifications.

[0105] Yang, et al. (Yang, N., et al., supra, 1996) showed using a far Western assay that GST-ERR.alpha.1 appears to interact with a fragment of ER.alpha. fused to GST. We performed a series of in vitro protein-protein binding assays as described above. ERR.alpha.1 was retained by GST-ER.alpha. as well as it was retained by GST-TFIIB (FIG. 9A, lanes 6-8). In a reciprocal experiment, labeled ER.alpha. was efficiently retained by GST-ERR.alpha.1 (FIG. 9B, lanes 1-4). To insure that these findings were truly a result of protein-protein interactions rather than concurrent binding to DNA fragments present in the protein preparations, this experiment was repeated in the presence of ethidium bromide, a chemical which disrupts protein-DNA interactions because it distorts the structure of the DNA: the presence of ethidium bromide did not significantly affect the retention of ER.alpha. by GST-ERR.alpha.1 (FIG. 9B, lanes 6-8 vs. 1-4). To confirm that the ERR.alpha./ER.alpha. protein-protein interaction was direct rather than via a third protein present in the lysates, the GST-fusion protein binding experiment was also performed with purified, recombinant ER.alpha.: ER.alpha. still bound to ERR.alpha.1 as efficiently as it did to TFIIB (Johnston, S. D., supra, 1996). Therefore, we conclude that ERR.alpha. and ER.alpha. can directly interact in vitro.

[0106] Preliminary experiments were performed to map the regions of ERR.alpha. that interact with ER.alpha.. Deletion mutants of ERR.alpha.1 were tested for their ability to bind ER.alpha. (FIG. 10). The [.sup.35S] methionine-labeled ER.alpha. protein was synthesized in a rabbit reticulocyte lysate. The GST fusion proteins, containing the amino acids of ERR.alpha.1 indicated, were synthesized in E. coli and purified using glutathione-Sepharose. Binding assays were performed as described in FIG. 9. B, ER.alpha. was found to bind most well the full-length protein (ERR.alpha.1 amino acids 1-423), and small deletions from the C-terminus of ERR.alpha. (ERR.alpha.1 amino acids 1-376) significantly reduced binding of ER.alpha.. However, moderate amounts of ER.alpha. still bound to ERR.alpha.'s DBD (amino acids 1-173); FIG. 10B). Thus, ER.alpha.-ERR.alpha. protein-protein interactions mediated through the C-terminus of ERR.alpha. may allow these receptors to cross-modulate each other's activites, and/or allow these receptors to interact while bound to differenent response elements from the same promoter.

[0107] Relative binding of ERR.alpha., ER.alpha. and COUP-TF1 to several EREs: We have shown that ERR.alpha. binds to known estrogen-response elements (see FIG. 5). In an attempt to compare the relative binding affinities of ERR.alpha. to that of ER.alpha. on any given ERE, we performed gel-mobility-shift assays as follows. The indicated radiolabeled double-stranded DNAs (EREs) were incubated with whole-cell extracts prepared from COS cells transfected with plasmids encoding the indicated receptor. The sequences of the vitellogenin (Vit) (lanes 2-4, FIG. 11) and prolactin D (Prol D) (lanes, 11-13, FIG. 11) probes are shown in FIG. 5. The sequences of the synthetic direct repeat element (DRE) (lanes 4-6, FIG. 11) and the pS2 (lanes 8-10, FIG. 11) probes were 5'-CCTGCAAGGTCACGGAGGTCACCCCG-3' (SEQ ID NO:3) and 5'-CCTGCAAGGTCACGGTGGCCACCCG-3' (SEQ ID NO:4), respectively.

[0108] Not surprisingly, the different EREs were found to bind each of the receptors with different relative affinities. For example, ERR.alpha. bound the ERE of the promoter of the pS2 gene with a higher affinity than did ER.alpha. (FIG. 11, lane 8 versus 9). On the other hand, ER.alpha. bound to the vitellogenin ERE more efficiently than did ERR.alpha., while COUP-TF1 failed to recognized this palindromic ERE at all (FIG. 11, lanes 2-4). The pS2 gene was cloned from a human breast cancer cell line, is subject to transcriptional activation upon the addition of estradiol to culture, and is frequently overexpressed in breast cancers (Berry, M., et al., PNAS 86:1218-1222, 1989. Thus, alterations in the amount or activity of ERR.alpha. in a cell may relate to some estrogen-involved malignancies. Given that ERR.alpha.2 is identical to ERR.alpha.1 in the DNA binding domain (FIG. 1B), it probably has a similar sequence specificity and, thus, may also relate to some estrogen-involved malignancies when altered.

[0109] Mutually exclusive binding of ER.alpha. and ERR.alpha.: To determine whether ERR.alpha. can compete with ER.alpha. for binding to some EREs, we performed gel-mobility-shift assays using the radiolabeled vitellogenin ERE double-stranded DNA as a probe and whole-cell extracts of COS cells transfected with the receptor proteins. Upon addition of increasing amounts of ERR.alpha.1, an increase in the amount of ERR.alpha.1-DNA complex was observed along with an approximately five-fold decrease in the amount of the ER.alpha.-DNA complex. In addition, no heterodimer-DNA complex was observed. Thus, ERR.alpha. can compete with ER.alpha. for binding to the vitellogenin ERE in a mutually exclusive manner.

[0110] In summary, we conclude that ERR.alpha. can probably affect the expression of some estrogen-responsive genes by competing with ER.alpha. for binding to EREs present in the promoters of these genes. Given this finding, we expect that changes in the amounts or activities of ERR.alpha. within a cell would likely lead to alterations in the expression of many estrogen-responsive genes and, thus, lead to changes in cells that could play roles in malignancies.

[0111] Discussion

[0112] We identified here the protein, ERR.alpha.1, that corresponds to the major mRNA (FIG. 3) and protein (FIG. 2) products synthesized in vivo from the ERR.alpha. gene. Using recombinant protein, we identified DNA binding sites in a variety of promoters (FIGS. 5 and 11) and found that the highest affinity sites contain the extended half-site sequence 5'-TCAAGGTCA-3'. Footprinting analysis confirmed that ERR.alpha. can bind this DNA sequence (FIG. 6). In addition, we showed that ERR.alpha. is capable of modulating transcription through its binding sites both in vitro (FIG. 7) and in vivo (FIG. 8). These are the first functional assays of ERR.alpha.. They may prove useful as the basis for a screen for ligands to ERR.alpha.. We also showed that ERR.alpha.1 interacts in vitro with ER.alpha. and TFIIB (FIG. 9); the interaction with ER.alpha. occurs via ERR.alpha.'s C-terminus (FIG. 10). Furthermore, ERR.alpha. binds with higher affinity than ER.alpha. to the ERE of the pS2 gene, a gene frequently overexpressed in breast cancer (FIG. 11) and competes with ER.alpha. for binding to some EREs. Thus, we predict that ERR.alpha. may modify the estrogen-responsiveness of some genes, including ones involved in some cancers. Furthermore, since ERR.alpha.2 conains the entire ERR.alpha.1 sequence plus additional N-terminal residues (FIG. 1B), we predict that ERR.alpha.2 may also modify the estrogen responsiveness of some genes, including ones involved in some cancers.

[0113] The ERR.alpha.1 protein: We and others (Yang, N., et al., supra, 1996) have failed to find evidence for a protein encoded by the ERR.alpha. cDNA described by Gigure, et al. (Gigure, V., et al., supra, 1988). We detected, instead, an mRNA (FIG. 3) with a 5'-end located 3' of the site needed to encode ERR.alpha.. This mRNA has the potential to code for a smaller ERR.alpha. protein which we named ERR.alpha.1. Its existence in vivo was confirmed by immunoblotting and immunoprecipitation experiments (FIG. 2). The structure of the mRNA identified here is in agreement with the genomic structure of the ERR.alpha. gene (Shi, et al., Genomics 44(1):52-60, 1997, incorporated by reference as if fully set forth herein). ERR.alpha.1 is a protein of approximately 53 kDa; however, other isoforms of ERR.alpha. may exist as well (e.g., ERR.alpha.2). ERR.alpha.1 is probably the same protein as the larger of two ERR.alpha. isoforms recently described by Yang, et al. (Yang, N., supra, 1996). We failed to detect the smaller, 42-kDa protein that Yang, et al. (Yang, N., supra, 1996) found by immunoblotting. This discrepancy is likely due to the use of different ERR.alpha.-specific antisera.

[0114] The ERR.alpha. binding site: A high-affinity ERR.alpha. binding site was determined to be the extended half-site sequence, 5'-TCAAGGTCA-3' (FIG. 5). This finding is in agreement with the prediction of Wilson, et al. (Wilson, T. E, et al., supra, 1993) made on the basis of the sequence similarity of the proximal A box of ERR.alpha. to SF-1. We also confirmed that the FP1 sequence of the human lactoferrin promoter is a strong ERR.alpha. binding site (FIG. 5; Yang, N., supra, 1996). Significant sequence variability in the 5' extension of the consensus half-site sequence is tolerated by ERR.alpha.. Most notably, the SV40 +55 UP mutant and the prolactin D sites each have a single base difference from the consensus 5'-extension, but were found to bind ERR.alpha. very well (FIG. 5). Indeed, many sequences that do not contain the 5'-TCA-3' extension were bound by ERR.alpha. at moderate levels. For example, the vitellogenin ERE, which contains two consensus half-sites (5'-AGGTCA-3') without an upstream 5'-TCA-3', was bound at reasonable levels by ERR.alpha. (FIG. 5).

[0115] Sequences outside of the 9-bp extended half-site also appear to play a role in determining a site's strength. For example, the SF-1, CYP1A2-1 and P450 scc oligonucleotides each contain a perfect consensus extended half-site, but their relative affinities varied more than 60-fold (FIG. 5). This finding is in agreement with the observation that ERR.alpha. contacts at least one base outside of the extended half-site (Yang, N., supra, 1996). On the other hand, the integrity of the core half-site sequence is clearly necessary, as mutations in the core of the vitellogenin ERE and SV40 +1 and +55 sites led to a complete loss of binding (FIG. 5).

[0116] ERR.alpha. was initially cloned on the basis of its sequence, rather than its function. Therefore, genes regulated by ERR.alpha. are largely unknown. The data from the quantitative, competition gel-mobility-shift assays (summarized in FIG. 5 and Table 3) indicated several promoters that may be regulated by ERR.alpha.. Also, binding sites other than the strongest binding sites may be true physiological targets. For example, the SV40-MLP contains two moderate-strength binding sites (FIG. 5), yet was repressed by ERR.alpha. in vitro (FIG. 7) and in vivo (FIG. 8) up to 10-fold. The physiologic importance of these ERR.alpha. binding sites awaits additional experiments.

[0117] Many sequences are recognized by multiple members of the steroid/thyroid hormone receptor superfamily: Many of the DNA sequences that have been shown here to be bound by ERR.alpha. are already known to bind other members of the steroid/thyroid hormone receptor superfamily. The highest affinity binding site we found is identical to an oligonucleotide that is strongly bound by SF-1 (Wilson, T. E, et al., supra, 1993). Additionally, the vitellogenin ERE (Klein-Hitpa.beta., L., et al., supra, 1986), the prolactin D sequence (Murdoch, F. E., et al., supra, 1995; Somasekhar, M. B., and Gorski, J., Gene 69:13-21, 1988), and the creatine kinase B sequence (Wu-Peng, X. S., et al., supra, 1992) are all known to be bound by ER.alpha. and mediate transcriptional induction by estrogens. The SV40 +1 and +55 sites are functionally bound by COUP-TF1, COUP-TF2, and TR.alpha.1/RXR.alpha. (Zuo, F., and Mertz, J. E., supra, 1995; Zuo, F., Ph.D. Thesis. Regulation of the SV40 late promoter by members of the steroid/thyroid hormone receptor superfamily. University of Wisconsin-Madison, 1995) as well as by ERR.alpha. (FIGS. 7 and 8). In this latter case, any of these superfamily members can repress transcription from the SV40-MLP. Thus, ERR.alpha. can bind to sequences that are also recognized by other members of the superfamily. The meaning of overlapping binding specificity remains unclear.

[0118] COUP-TFs have been shown to repress transactivation by many members of the steroid/thyroid hormone receptor superfamily (Qiu, Y., et al., Endocrinol. Metab. 5:234-239, 1994). COUP-TFs can repress by multiple mechanisms, including competition for DNA binding sites (Cooney, A. J., et al., J. Biol. Chem. 268:4152-4160, 1993; Liu, Y., et al., Mol. Cell. Biol. 13:1836-1846, 1993). Because ERR.alpha. binds to several functional EREs (FIG. 5, Table 3 in Example 4), it may function in a similar manner to COUP-TFs by acting as a general repressor of estrogen-regulated genes in the absence of liganded ERs. In the presence of estrogen or an increase in the molar ratio of ER to ERR.alpha., activated ER may displace ERR.alpha., allowing for both true activation and anti-repression of the target genes. Data presented in Example 2 further explore the mechanisms of ERR.alpha.-mediated down-modulation and illustrate that this factor also contains a repressor domain. ERR.alpha. has also been demonstrated to contain a transactivation domain (Lydon, J. P., et al., supra, 1992). Thus, it is likely that ERR.alpha. can transcriptionally activate targets in some contexts. In the case of the lactoferrin promoter, the ERR.alpha. binding site is necessary for maximal transactivation by ER.alpha. acting through a weak, downstream ERE (Yang, N., et al., supra, 1996). Because most members of the steroid/thyroid hormone receptor superfamily are not ubiquitously expressed, the ability of some sites to be bound by several members of the superfamily may effectively increase the number of tissues in which an element is recognized. Finally, there may be additional requirements for receptor binding to these promoter sites that are not fully reproduced in these in vitro systems.

[0119] In summary, we have shown here that a major isoform of the ERR.alpha. gene is ERR.alpha.1. We have characterized high-affinity binding sites for ERR.alpha., shown that ERR.alpha. can bind some EREs with higher affinity than does ER.alpha. and compete with ER.alpha. for binding to some EREs, and developed the first functional assays for ERR.alpha. activity. Furthermore, because this receptor binds both ER.alpha. and EREs, we propose that ERR.alpha.1 and, by analogy, ERR.alpha.2 likely play roles in estrogen responsiveness.

EXAMPLE 2

Estrogen-related Receptor .alpha. Actively Antagonizes Estrogen Receptor-regulated Transcription in MCF-7 Mammary Cells

[0120] Abstract

[0121] The estrogen-related receptor .alpha. (ERR.alpha.) is an orphan member of the nuclear receptor superfamily. We show that the major isoform of the human ERR.alpha. gene, ERR.alpha.1, can sequence-specifically bind a consensus palindromic estrogen response element (ERE) and directly compete with estrogen receptor .alpha. (ER.alpha.) for binding. ERR.alpha. activates or represses ERE-regulated transcription in a cell type-dependent manner, repressing in ER-positive MCF-7 cells while activating in ER-negative HeLa cells. Thus, ERR.alpha. can function both as a modulator of estrogen responsiveness and as an estrogen-independent activator. Repression likely occurs in the absence of exogenous ligand since charcoal treatment of the serum had no effect on silencing activity. Mutational analysis revealed that repression is not simply the result of competition between ER and ERR.alpha. for binding to the DNA. Rather, it also requires the presence of sequences within the carboxyl-terminal E/F domain of ERR.alpha.. Thus, ERR.alpha. can function as either an active repressor or a constitutive activator of ERE-dependent transcription. We hypothesize that ERR.alpha. can play a critical role in the etiology of some breast cancers, thereby providing a novel therapeutic target in their treatment.

[0122] Introduction

[0123] The nuclear receptor (NR) superfamily is comprised of hundreds of transcription factors that regulate a vast array of genes and physiological responses (1-9). Most nuclear receptors share a similar structural organization (FIG. 12A). The amino-terminal A/B domain can function as a hormone-independent activator of transcription. The highly conserved C domain contains the DNA binding domain (DBD) that confers sequence-specific DNA binding activity. A hinge region, called the D domain, bridges the C domain with the carboxyl-terminal E/F domain that includes the receptor-specific ligand binding domain (LBD) of the protein. The binding of appropriate ligands results in conformation changes leading to alterations in the transcriptional properties of the receptor, including the exposure of a transcriptional activation region within the carboxyl end. Although many nuclear receptor superfamily members bind known ligands (e.g., steroids, retinoids, thyroid hormones), some, termed orphan receptors, share significant sequence similarity in their LBDs with their ligand binding family members but lack as-yet known naturally occurring ligands (7-10)

[0124] Among the first orphan receptors identified were the estrogen-related receptors ERR.alpha. and ERR.beta. (officially named NR3B1 and NR3B2, respectively) (10). They were cloned by low stringency screening of cDNA libraries with probes corresponding to the DBD of estrogen receptor .alpha. (ER.alpha.) (10). Subsequently, ERR.alpha.1 was identified as the major isoform present in HeLa cells (FIG. 12A) (11, 12). The DBD of human ERR.alpha. shares 70% amino acid similarity with the DBD of human ER.alpha.; the LBD shares 35% amino acid identity. A third member of the ERR family, ERR.gamma. (NR3B3), has also been identified (13-15). These three ERRs are closely related by sequence similarity but encoded by different genes.

[0125] Despite sequence similarity with ERs in the LBD, the ERRs do not bind 17.beta.-estradiol (11, 15, 16), and the identification of naturally occurring ligands for ERR family members has remained elusive. Vanacker et al. (17) reported that a serum component removable by treatment with charcoal regulates ERR.alpha.-dependent transcription. However, remaining unclear is whether this factor(s) acts directly by binding to ERR.alpha. or indirectly through a signal transduction pathway. Yang and Chen (18) found that the pesticides toxaphene and chlordane decrease the activity of ERR.alpha., whereas others reported that ERRs can constitutively interact with co-activators independent of any ligand (19-23). Interestingly, the synthetic estrogen diethylstilbestrol has been shown to antagonize the activation function of ERR family members by disrupting ERR.alpha. interactions with coactivators (22, 23); 4-hydroxytamoxifen acts likewise, but only with ERR.gamma., not ERR.alpha. (24). Thus, ligands appear to affect the activities of ERRs, but via non-classical mechanisms.

[0126] The ERRs also differ somewhat from the ERs in their binding site specificities. They recognize estrogen response elements (EREs) (11, 25-29); however, ERR.alpha. binds with even higher affinity to the consensus steroidogenic factor-1 response element-extended half-site sequence 5'-TCAAGGTCA-3' (11, 27, 26). Interestingly, the sequence 5'-TAAAGGTCA-3' is also recognized by ERR.alpha. but not by steroidogenic factor-1 (17). Therefore, some genes likely contain estrogen-related receptor response elements regulated only by ERR family members. Thus, ERR family members likely signal via cross-talk with other nuclear receptors through common binding sites as well as ERR-specific genes via ERR-binding sites.

[0127] The ERR family members have been shown to function in numerous cell types as transcriptional activators of promoters containing EREs, steroidogenic factor-1 response elements, and ER response elements (16-31). Nevertheless, we found that ERR.alpha. repressed rather than activated transcription in ER-negative CV-1 cells when it binds sites within the late promoter of SV40 (11, 32). Thus, ERRs likely modulate gene expression via several mechanisms.

[0128] To better understand the multiple activities of ERR.alpha., we investigated here the effects of ERR.alpha. on expression from an ERE-regulated promoter in ER-positive versus ER-negative cells. We show that ERR.alpha. can function as either a repressor or activator of ERE-mediated transcription in a cell type-dependent manner. The mechanism of repression involves interactions with cellular corepressor(s) as well as binding to the ERE. We propose ERR.alpha. likely plays roles in the etiology of some breast cancers and the progression from an ER-dependent to ER-independent state.

[0129] Materials and Methods

[0130] Plasmids: All plasmid DNAs were constructed by standard recombinant DNA techniques. Plasmid p3xERE-TK-luc, a gift from V. C. Jordan, contains three tandem copies of the palindromic ERE sequence 5'-TAAGCTTAGGTCACAGTGACCTAAGCTTA-3' (SEQ ID NO:9), placed upstream of a minimal herpes simplex thymidine kinase (TK) promoter (nucleotides -109 to +52 relative to the transcriptional start site of the TK promoter), directing expression of the luciferase coding sequence (33). The ERE-negative control plasmid, pTK-luc, was generated from p3xERE-TK-luc by cleavage at the two HindIII sites directly surrounding the three EREs and ligation.

[0131] Plasmid pcDNA3.1-hERR.alpha.1 encodes wild-type human ERR.alpha.1 expressed from the cytomegalovirus promoter. It was constructed by reverse transcription-PCR amplification of ERR.alpha. mRNA isolated from normal human mammary gland RNA (CLONTECH, Palo Alto, Calif.) followed by PCR-based cloning of the coding region into pcDNA3.1/V5-His (Invitrogen). To ensure efficient initiation and termination of translation of the ERR.alpha. open reading frame, the cloning was performed using the primers 5'-gacttcGCCACCATGAGCAGCCAGGTGGTGGTGCATTGA-3' (SEQ ID NO:10) (lowercase letters indicate an EcoRI site, underlined letters indicate the translation initiation codon, and bold letters indicate bases altered to optimize translation initiation while maintaining coding of the wild-type ERR.alpha.1 protein) and 5'-ggatccTCAGTCCATCATGGCCTCGAGCAt-3' (SEQ ID NO:11) (lowercase letters indicate a BamHI site, and underlined letters indicate the translation termination codon). DNA sequence analysis confirmed that the protein encoded by this plasmid corresponds to the wild-type ERR.alpha.1 referenced in GenBank entry NM-004451.

[0132] Plasmids pcDNA3.1-hERR.alpha.1.sub.1-173, pcDNA3.1-hERR.alpha.1.sub- .76-423, pcDNA3.1-hERR.alpha.1.sub.L413A/L418A, and pcDNA3.1-hERR.alpha.1.sub.P-box encode mutant variants of ERR.alpha.1 (FIG. 12B). They were constructed by PCR-based methods with pcDNA3.1-hERR.alpha.1 as the starting template. For pcDNA3.1-hERR.alpha.1.sub.1-173 and pcDNA3.1-hERR.alpha.1.sub.L413A/L418A- , the primers used for the termination codon-containing plasmids were, respectively, 5'-ggatccTCACGGGAAGGGCAGTGGGTCCA-3' (SEQ ID NO:12) and 5'-ggatccTCAGTCCATCATGGCCTCGGCCATCTCCAAGAACGCCTTGTGCATGGGCACCTTGC-3' (SEQ ID NO:13) (bold letters indicate bases altered to change leucine codons to alanine). Likewise, pcDNA3.1-hERR.alpha.1.sub.76-423 was constructed using 5'-gaattcGCCACCATGAAGCGCCTCTGCCTGGTCT-3' (SEQ ID NO:14) for the initiation codon-containing primer.

[0133] Plasmid pcDNA3.1-hERR.alpha.1.sub.P-box contains three amino acid substitution mutations (E97G/A98S/A101V) within the predicted P-box of the ERR.alpha.1 DNA binding domain that abrogate the ability of the protein to bind DNA. It was constructed by PCR amplification of the open reading frame of ERR.alpha.1 in two directly abutting fragments corresponding to the amino and carboxyl termini of the protein. The ERR.alpha.1.sub.P-box amino-terminal fragment was amplified using as primers the wild-type translation initiation codon-containing primer and 5'-phosphate-GGACCCACAGGATGCCACACCATAGTGGTA-3' (SEQ ID NO:15). The ERR.alpha.1.sub.P-box carboxyl-terminal fragment was amplified using as primers the wild-type translation termination codon-containing primer and 5'-phosphate-TGCAAAGTCTTCTTCAAGAGGACCATCCA-3' (SEQ ID NO:16). The resulting PCR products were digested with EcoRI and BamHI, respectively, ligated together, and re-amplified using the wild-type initiation and termination codon-containing primers to produce the full-length ERR.alpha.1.sub.P-box mutant.

[0134] Cells: The ER-positive, human mammary carcinoma MCF-7 cell line was cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS), 6 ng of insulin/ml, 3 .mu.g of glutamine/ml, and 100 units of penicillin and streptomycin/ml. The ER-negative, human cervical HeLa cell line and the monkey kidney COS-M6 cell line were cultured in Dulbecco's modified Eagle's medium supplemented with 10% FBS and 100 units of penicillin and streptomycin/ml. When cells were cultured in estrogen-free medium, referred to here as stripped medium, dextran-coated charcoal-treated FBS (34) replaced whole FBS and phenol red-free RPMI 1640 replaced RPMI 1640.

[0135] Transient Transfections and Luciferase Assays: To assess the role ERR.alpha. plays in regulating transcription of an ERE-containing promoter, MCF-7 or HeLa cells grown in 12-well tissue culture plates were co-transfected in parallel with 0.5 .mu.g of pTK-luc versus p3xERE-TK-luc along with the indicated amounts of the empty cloning vector pcDNA3.1, the ERR.alpha.1 expression plasmid pcDNA3.1-hERR.alpha.1, or mutant variants thereof. Transfections were performed with the aid of the TransIT LT1 transfection reagent (PanVera, Madison, Wis.) as previously described (35). To examine the effects of ER ligands, cells were maintained in stripped medium for 48 h before transfection and the addition of 17.beta.-estradiol (E.sub.2) (Sigma) or the pure anti-estrogen ICI-182,780 (Astra Zeneca, London, UK) dissolved in ethanol and diluted in medium to obtain the indicated concentrations. Cells were harvested 48 h post-transfection, and lysates were assayed for luciferase activity normalized to protein concentration as previously described (36).

[0136] Ectrophoretic Mobility Shift Assays (EMSAs): EMSAs were performed essentially as described by Reese et al. (37) using whole-cell extracts prepared as described previously (35). Briefly, whole-cell extracts obtained from five 10-mm dishes of COS-M6 cells that had been transfected 48 h previously with 3 .mu.g/dish of the desired expression plasmid served as the source of NRs. Transfections were performed with the aid of the TransIT LT1 transfection reagent as previously described (35). The radiolabeled double-stranded synthetic oligonucleotide 5'-TAAGCTTAGGTCACAGTGACCTAAGCTTA-3' (SEQ ID NO:9) served as the ERE probe. One to five .mu.l of extract (10-100 .mu.g of protein) was preincubated on ice for 20 min in a 16-.mu.l reaction mixture containing 20 mM HEPES (pH 7.4), 1 mM dithiothreitol, 100 mM NaCl, 10% glycerol (v/v), 3 .mu.g of BSA, and 4 .mu.g of poly(dI-dC). Radiolabeled probe (about 1.0 ng) was added, and the mixture was incubated for 15 min at room temperature. The samples were loaded directly onto a 5% non-denaturing polyacrylamide gel with 0.5.times.Tris-buffered EDTA as running buffer and electrophoresed at 200 V for 2 h at 4.degree. C. Immunoshift assays were performed by the addition of the indicated antiserum at the preincubation step. The ER.alpha.-specific antiserum was the monoclonal antibody H222 (kindly provided by Dr. Geoffrey Greene). The ERR.alpha.-specific antiserum was the previously described polyclonal one raised in rabbits against glutathione S-transferase GST-ERR.alpha.1.sub.17-329 (11).

[0137] Western Blots: To determine whether the NRs were efficiently and correctly expressed, 5-10 .mu.g of whole-cell extract containing the overexpressed NR were resolved by SDS, 12% PAGE. The proteins in the gel were electroblotted onto a nitrocellulose membrane. The membranes were probed with a rabbit polyclonal antiserum raised against GST-ERR.alpha.1 (11) followed by anti-rabbit IgG peroxidase (1:1000 dilution). The retained antibodies were detected by enhanced chemiluminescence.

[0138] Results

[0139] Competition between ERR.alpha. and ER.alpha. for Binding an ERE: Johnston et al. (11) and others (12) showed previously that ERR.alpha. can bind to some naturally occurring EREs. To test whether ERR.alpha. recognizes the palindromic ERE sequence, 5'-TAAGCTTAGGTCACAGTGACCTAAGCTTA- -3' (SEQ ID NO:9), EMSAs were performed using whole-cell extracts obtained from COS-M6 cells that contained overexpressed ER.alpha. or ERR.alpha.1 as protein source and a radiolabeled, double-stranded synthetic oligonucleotide that contained the palindromic ERE sequence as probe. As shown in FIG. 15, both ER.alpha. and ERR.alpha. bound to this synthetic ERE. ER.alpha. generated a protein-DNA complex that was immunoshifted with the ER.alpha.-specific antibody H222 but not with the ERR.alpha.-specific antiserum. ERR.alpha. also bound the ERE, generating a single protein-DNA complex that migrated faster than the ER.alpha.-DNA complex and was immunoshifted with the ERR.alpha.-specific antibody but not with the ER.alpha.-specific antiserum. Thus, both ER.alpha. and ERR.alpha. can bind this palindromic sequence.

[0140] To determine whether the binding of ERR.alpha. and ER.alpha. to this ERE is mutually exclusive, cooperative, or competitive, EMSAs were performed with a constant amount of ER.alpha. plus various amounts of ERR.alpha.1 mixed together in the same binding reaction. As shown in FIG. 15, the addition of increasing amounts of ERR.alpha.1 yielded an increase in the amount of ERR.alpha.1-DNA complex along with a corresponding decrease in the amount of ER.alpha.-DNA complex. Similar results were obtained when this competition experiment was performed with extracts of COS-M6 cells that had been co-transfected with various molar ratios of the ER.alpha.- and ERR.alpha.-expressing plasmids. Thus, the binding of ERR.alpha. and ER.alpha. to this palindromic ERE is mutually exclusive, with ERR.alpha. effectively competing with ER.alpha. for binding when present in sufficient amounts.

[0141] ERR.alpha. Represses Transcription in MCF-7 Cells: Because ERR.alpha. can interfere with the binding of ER.alpha. to this ERE, might it affect estrogen-responsive transcription? To answer this question, we co-transfected ER.alpha.-positive mammary MCF-7 cells in parallel with p3xERE-TK-luc, a reporter plasmid containing three tandem copies of this ERE (FIG. 14A) or the ERE-negative control plasmid, pTK-luc, together with 0.12 or 0.25 .mu.g of the ERR.alpha.1 expression plasmid, pcDNA3.1-hERR.alpha.1, or the empty parental expression plasmid, pcDNA3.1. After incubation for 48 h in medium containing whole FBS, the cells were harvested and assayed for luciferase activity. The presence of the EREs conferred an about 150-fold increase in transcriptional activity above the level observed in the cells transfected with the ERE-negative reporter plasmid (FIG. 14B). This ERE-dependent activity was extremely sensitive to treatment with the anti-estrogen ICI-182,780, indicating the activation is dependent upon ER and the presence of estrogens in the FBS (FIG. 14B). Overexpression of ERR.alpha. repressed this ERE-dependent transcriptional activity about 3-4-fold (FIG. 14B; see also FIG. 18B) while exhibiting little if any effect on expression of the control pTK-luc reporter plasmid (FIGS. 14, B and C). Thus, ERR.alpha. inhibits the estrogen-responsive activation of transcription from this ERE-containing promoter in this ER-positive MCF-7 cell line.

[0142] ERR.alpha. Modulates Estrogen-responsiveness in MCF-7 Cells: To directly examine the effect of ERR.alpha. on the response to estrogen, MCF-7 cells were cultured in medium containing estrogen-free charcoal-stripped FBS and cotransfected as described above but in the absence or presence of E.sub.2. In the absence of exogenous E.sub.2, p3xERE-TK-luc was expressed at an approximately 50-fold higher level than pTK-luc, activity that was largely ablated by treatment with the anti-estrogen ICI-182,780 (FIG. 15A). Once again, overexpression of ERR.alpha. repressed ERE-dependent transcription approximately 3-fold while having little if any effect on transcription of the control reporter (FIG. 15A).

[0143] The addition of 1.times.10.sup.-10 M E.sub.2, a physiological concentration, to the medium dramatically induced transcriptional activity of the ERE-containing reporter plasmid approximately 10-fold above the level observed in the absence of exogenous E.sub.2 (FIG. 15, B versus A). Consistent with this induction being mediated by ER, it was completely eliminated by incubation of the cells with the anti-estrogen ICI-182,780 (FIG. 15B). Strikingly, overexpression of ERR.alpha. inhibited this E.sub.2-mediated activation of transcription from the ERE-containing promoter 3-5-fold, while, again, having little if any affect on expression of the ERE-negative control, pTK-luc (FIG. 15B).

[0144] Lastly, when the co-transfected cells were incubated with 1.times.10.sup.-8 M E.sub.2, a non-physiological concentration, ERE-dependent transcription was stimulated an additional 3-fold over the level of activity observed with 10.sup.-10 M E.sub.2 to a level approximately 30-fold above the activity observed in the absence of exogenous E.sub.2 (FIG. 15C). Again, this activity was extremely sensitive to treatment with the anti-estrogen ICI-182,780 (FIG. 15C), consistent with high concentrations of E.sub.2 generating high levels of liganded, active ER. However, overexpression of ERR.alpha. no longer inhibited this E.sub.2-mediated activation of transcription from p3x ERE-TK-luc (FIG. 15C). Thus, we conclude that ERR.alpha. can modulate estrogen responsiveness when its concentration relative to E.sub.2-occupied ER.alpha. is sufficient to allow effective competition for binding to the ERE.

[0145] ERR.alpha. Represses Transcription by an Active Mechanism: What is the mechanism by which ERR.alpha. inhibits ER-mediated transcriptional activation? One possibility is that it simply competes with ER.alpha. for mutually exclusive binding to EREs, thereby blocking binding of the transcriptional activator. Alternatively, ERR.alpha. may contain a regulatory domain(s) as well as a DNA binding domain that plays an active role in modulating transcription from ERE-containing promoters.

[0146] To distinguish between these two hypotheses, we constructed several variants of pcDNA3.1-hERR.alpha.1 (FIG. 12B) and determined their DNA binding and transcriptional activities. Plasmid pcDNA3.1-hERR.alpha.1.sub- .1-173 encodes a carboxyl-terminal-deleted variant of full-length ERR.alpha.1 that retains the amino-terminal A/B and DNA binding domains but lacks the E/F domains. Thus, ERR.alpha.1.sub.1-173 is unable to bind putative ligands, ligand-dependent coactivator complexes, and, possibly, corepressor complexes. Immunoblotting with an antiserum specific for ERR.alpha. indicated that ERR.alpha.1.sub.1-173 was expressed at levels comparable with, if not higher than full-length ERR.alpha.1 (FIG. 16A). EMSAs indicated that ERR.alpha.1.sub.1-173 forms a protein-DNA complex with the palindromic ERE that can be immunoshifted with the ERR.alpha.-specific antiserum (FIG. 16B). Most importantly, ERR.alpha.1.sub.1-173 efficiently competed for binding to this ERE with both ER.alpha. (FIG. 17A) and full-length ERR.alpha.1 (FIG. 17B). Therefore, synthesis of ERR.alpha..sub.1.sub.1-173 in MCF-7 cells would also be predicted to result in inhibition of ER-mediated transcription if repression were caused simply by passive binding of ERR.alpha. to the ERE. However, contrary to the result observed with full-length ERR.alpha.1 (FIGS. 14B and 18B), overexpression of ERR.alpha.1.sub.1-173 failed to repress transcription of either pTK-luc (FIG. 18A) or p3xERE-TK-luc (FIG. 18B); rather, it slightly enhanced transcription of p3xERE-TK-luc (FIG. 15B).

[0147] A second variant examined was ERR.alpha.1.sub.76-423. This amino-terminal-deleted variant of ERR.alpha.1 lacks the A/B domain but retains the entire ligand and DNA binding domains (FIG. 12B). Immunoblots indicated that ERR.alpha.1.sub.76-423 appeared to accumulate in transfected cells to somewhat lower levels than full-length ERR.alpha.1 (FIG. 16A). It is unclear whether the ERR.alpha.1.sub.76-423 variant protein lacks some of the epitopes recognized by the polyclonal ERR.alpha.-specific antiserum used here, thus resulting in it being detected at lower efficiency, or that it actually accumulated to lower levels because of differences in rates of synthesis or stability. Regardless, sufficient quantities of protein accumulated for studies of DNA binding and transcriptional activity. As expected, ERR.alpha.1.sub.76-423 was found both to bind to the palindromic ERE (FIG. 16B) and to repress transcription of p3xERE-TK-luc approximately 2-3-fold (FIG. 18B). Thus, although both ERR.alpha.1.sub.76-423 and ERR.alpha.1.sub.1-173 bind to the ERE, only ERR.alpha.1.sub.76-423 represses ERE-dependent transcription. Therefore, a domain(s) of ERR.alpha. mapping within the carboxyl-terminal region of the protein in addition to its DNA binding domain is required for repression. These findings support an active model of transcriptional repression in which ERR.alpha. represses transcription by recruiting cellular corepressor(s) to the promoter.

[0148] As is true for most NRs, ERR.alpha. contains a coactivator binding motif or NR box. The ERR.alpha.1 NR box, located between amino acids 413 and 418, is comprised of the sequence LXLXXL (SEQ ID NO:17). This sequence differs slightly from the consensus NR box motif, LXLXXL (38-42) (SEQ ID NO:17). To examine the effect of inactivation of this coactivator binding motif on transcriptional activity, we constructed pcDNA3.1-hERR.alpha.1.sub.413A/418A. The ERR.alpha.1 variant encoded by this plasmid contains alanine substitution mutations in place of the leucine residues at amino acids 413 and 418. Immunoblots indicated that ERR.alpha.1.sub.413A/418A efficiently accumulated in transfected cells (FIG. 16A). EMSAs showed that it specifically bound the palindromic ERE (FIG. 16B). Interestingly, ERR.alpha.1.sub.413A/418A repressed ERE-dependent transcription more efficiently than did full-length ERR.alpha.1, i.e. approximately 5-8-fold versus 3-4-fold, respectively (FIG. 18B). Somewhat surprisingly, ERR.alpha.1.sub.413A/418A up-regulated ERE-independent or TK-luc transcription approximately 2-fold (FIG. 18A), likely the result of sequestration by overexpressed ERR.alpha.1.sub.413A/418A of corepressors utilized by this control promoter. Thus, the repressive effect of ERR.alpha.1.sub.413A/418A on ERE-dependent transcription was 10-16-fold if normalized to the control. Quite likely, ERR.alpha. contains both corepressor and coactivator binding domains, with these domains acting in concert to determine the overall effect of ERR.alpha. on transcription. Thus, inactivation of the coactivator binding NR box motif potentiates repression by ERR.alpha..

[0149] Last, we constructed pcDNA3.1-hERR.alpha.1.sub.P-box. This plasmid encodes a variant of ERR.alpha.1 containing three amino acid substitution mutations within the DNA binding domain (FIG. 12B). ERR.alpha.1.sub.P-box accumulated to normal levels in transfected cells (FIG. 16A). As expected, it was incapable of binding to the palindromic ERE (FIG. 16B). ERR.alpha.1.sub.P-box also failed to interfere with the binding of either ER.alpha. (FIG. 17A) or wild-type ERR.alpha.1 to the palindromic ERE (FIG. 17B). Most interestingly, overexpression of ERR.alpha.1.sub.P-box led to a 2-3-fold induction of ERE-dependent transcription (FIG. 18) rather than repression or no effect. Induction could not have been a consequence of sequestration of endogenous ERR.alpha. away from the ERE via protein-protein interactions since ERR.alpha.1.sub.P-box did not interfere with binding of wild-type ERR.alpha.1 to the ERE. Rather, ERR.alpha.1.sub.P-box likely sequestered cellular corepressors away from DNA-bound endogenous ERR.alpha., thereby relieving repression. These findings provide further support for the hypothesis that ERR.alpha. probably functions as a repressor of E.sub.2-stimulated, ERE-dependent transcription via an active mechanism.

[0150] ERR.alpha. Activates Transcription in HeLa Cells: Our finding that ERR.alpha. represses transcription from an ERE-controlled promoter was somewhat surprising since most reports in the literature conclude that ERR family members function as transcriptional activators of ERE-dependent transcription (17-31). To determine whether the transcriptional repression observed here was dependent upon the cell line, we repeated the cotransfection experiments as described above except using ER-negative HeLa cells in place of ER-positive MCF-7 cells (FIG. 19). Contrary to the results obtained in MCF-7 cells (FIGS. 14B and 18B), overexpression of ERR.alpha. in HeLa cells resulted in a 2.5-fold activation of transcription from the p3xERE-TK-luc reporter plasmid (FIG. 19A). A similar level of ERE-dependent activation was also observed in CV-1 and COS-M6 cells, other ER-negative cell lines. Thus, ERR.alpha. is a constitutive, estrogen-independent activator of transcription in these ER-negative cell lines. We conclude that ERR.alpha. can function as either a repressor or activator of ERE-dependent transcription in a cell type-specific manner.

[0151] Also noteworthy is the fact that the transcriptional activity of the ERE-containing p3xERE-TK-luc plasmid was already approximately 100-fold higher than that of its matched ERE-negative control plasmid, pTK-luc, even in the absence of overexpressed ERR.alpha.1 (FIGS. 19, A versus B). Unlike in MCF-7 cells (FIG. 14B), in HeLa cells this ERE-dependent activity was completely insensitive to the anti-estrogen ICI-182780 (FIG. 19A) and, therefore, not mediated by ERs. Because HeLa cells contain high endogenous levels of ERR.alpha. (Ref. 32, data not shown), we conclude that endogenous ERR.alpha., not ER.alpha., likely mediated this high ERE-dependent transcriptional activity in these cells. Furthermore, the only modest induction observed in HeLa cells with overexpressed ERR.alpha.1 was likely due to the already abundant presence of endogenous ERR.alpha.. Thus, we conclude that ERR.alpha. is a strong constitutive activator of ERE-dependent transcription in HeLa cells.

[0152] Discussion

[0153] We examined here the transcriptional properties of ERR.alpha. when it acts via binding an ERE. We showed that ERR.alpha. directly competes with ER.alpha. for binding to a consensus palindromic ERE and down-modulates the transcriptional response to estrogen in an ERE-dependent manner in MCF-7 cells (FIGS. 14 and 15). Using variants of ERR.alpha.1, we further showed that repression is not simply the result of ERR.alpha. interfering with the binding of ER.alpha. to DNA; rather, it occurs via an active mechanism. Interestingly, ERR.alpha. functions as an activator rather than a repressor of this same promoter via its EREs in ER-negative HeLa cells (FIG. 19). Thus, ERR.alpha. operates as an active repressor or activator of ERE-dependent transcription based upon other properties of the cell.

[0154] Down-modulation of Estrogen Response by ERR.alpha.: What is the mechanism by which overexpression of ERR.alpha.1 in ER-positive MCF-7 cells leads to antagonism of the response of an ERE-containing promoter to estrogens? We showed that ERR.alpha. competes with ER.alpha. for binding to the consensus palindromic ERE. We hypothesize that estrogen responsiveness is governed by the percentage of EREs occupied by ER.alpha., with ERE occupancy determined by the relative concentrations of E.sub.2-activated ER.alpha. and ERR.alpha. in the cell. MCF-7 cells contain high endogenous levels of ER.alpha. (33) that exist in a ligand-activated complex when E.sub.2 is present. In this case, most EREs are bound by ligand-activated ER.alpha., and expression of the reporter gene is high (FIG. 15C). On the other hand, when ERR.alpha. is overexpressed and there is little ligand-activated ER.alpha. present, most EREs are bound by ERR.alpha., and expression of the reporter gene is low (FIG. 15A). In this way, expression of the ERE-containing promoter is regulated by cross-talk between these two nuclear receptors. Thus, the level of expression of an ERE-dependent gene depends in part upon the relative amounts of ERR.alpha. and ligand-activated ER.alpha. in the cell.

[0155] Mechanism of Repression by ERR.alpha.: Previously, Burbach et al. (43) showed that COUP-TF1 represses estrogen-dependent stimulation of the oxytocin gene by simply competing with ER.alpha. for binding to an ERE. However, based upon analysis of variants of ERR.alpha., we conclude here that repression by ERR.alpha. involves, instead, an active silencing mechanism. First, ERR.alpha.1.sub.1-173 retains its DNA binding activity (Ref. 21; results section in this Example), yet failed to repress transcription (FIG. 18). Thus, simply blocking the binding of ER.alpha. is not sufficient for ERR.alpha. to repress ERE-mediated transcription. Second, ERR.alpha.1.sub.76-423, a variant lacking the amino-terminal domain but retaining both the DNA binding and carboxyl-terminal domains repressed transcription as well as full-length ERR.alpha.1 (FIG. 18). Therefore, in addition to the DNA binding domain, a region within the carboxyl terminus is required for ERR.alpha. to repress E.sub.2-stimulated, ERE-dependent transcription. Third, ERR.alpha.1.sub.413A/418A, a variant containing mutations only within the LXLXXL (SEQ ID NO:17) coactivator binding NR box motif, repressed E.sub.2-stimulated, ERE-dependent transcription more efficiently than did wild-type ERR.alpha.1 (FIG. 18). We interpret this latter result to indicate that ablation of the NR box disrupts the balance of ERR.alpha.-bound co-regulators, thereby allowing any putative corepressor bound to ERR.alpha. to act more effectively. Last, ERR.alpha.1.sub.P-box, a variant whose DNA binding activity was abrogated but coregulator binding domains were left intact, specifically up-regulated rather than antagonized ERE-dependent transcription (FIG. 18). This latter finding is likely a consequence of repression domains present within ERR.alpha.1.sub.P-box competing with endogenous wild-type ERR.alpha. for binding cellular corepressors, thereby preventing endogenous ERE-bound ERR.alpha. from antagonizing transcription. Furthermore, ERR.alpha. can function as an active repressor even in the absence of ER.alpha.. For example, we have found that ERR.alpha. represses SV40 late gene expression in ER-negative CV-1 cells both from the natural ERR.alpha. response elements overlapping the transcription initiation site of the SV40 major late promoter (11) and when this ERR.alpha. response element is relocated to 50 bp upstream of the transcription initiation site. Taken together with previous findings of others (20), these results provide evidence that ERR.alpha. contains both repression and activation domains. We have also shown elsewhere (44) that silencing mediator for retinoid and thyroid hormone receptors (SMRT) is one of the corepressors that can bind ERR.alpha., binding within the hinge region of ERR.alpha.. Additional experiments will be needed to identify the corepressors of ERR.alpha. and to definitively map their sites of binding.

[0156] Contrary to our findings with ERR.alpha.1.sub.1-173, Zhang and Teng (21) reported that the amino-terminal region of ERR.alpha.1 contains repressor activity. However, they assayed the effects of Gal4DBD-ERR.alpha.1 chimeras on expression of a Gal4 reporter rather than non-chimeric variants of ERR.alpha.1 binding via the ERR.alpha. DNA binding domain to an ERE. Whether these differences in experimental design can account for the seemingly contradictory conclusion is not yet clear.

[0157] ERR.alpha. has also been shown to bind ER.alpha. directly (11). Thus, alternative, non-mutually exclusive hypotheses to explain the ability of ERR.alpha. to down-modulate ERE-dependent transcription include (i) ERR.alpha. forming true heterodimers with ER.alpha. that can bind EREs and (ii) ERR.alpha. interacting with ER.alpha. in ways that abrogates the ability of ER.alpha. to bind EREs. However, we failed to observe ER.alpha.-ERR.alpha. heterodimeric complexes in either the experiments presented here or EMSAs performed using whole-cell extracts obtained from COS-M6 cells co-transfected with the ER.alpha. and ERR.alpha. expression plasmids. Moreover, the presence of ERR.alpha.1.sub.P-box failed to interfere with the binding of ER.alpha. to DNA. Taken collectively, these data indicate that ERR.alpha. likely functions as a repressor independently of any ability to bind ER.alpha..

[0158] Activation of Transcription by ERR.alpha.: Confirming prior reports (17-31), we have also observed that ERR.alpha. can activate transcription from an ERE-regulated promoter (FIG. 19). We show here for the first time that whether ERR.alpha. functions as a repressor or activator of a specific promoter can depend upon the cell type (FIGS. 14 versus 19). What factors determine the activity of ERR.alpha.? Several possibilities exist. First, the activities of ERR.alpha. might be ligand-dependent. Previous reports appear to be contradictory as to the existence of an exogenous activating ligand. One indicated that transcriptional activation by ERR.alpha. depends upon a component present in serum (17). Others claimed that ERRs are not activated by naturally occurring ligands (19, 20). In the experiments reported here, the same serum was present in the medium in which the HeLa and MCF-7 cells were cultured; nevertheless, ERR.alpha. exhibited markedly different activities in these cell types (FIGS. 14 versus 19). Thus, if an activating ligand of ERR.alpha. exists in FBS, it probably does not exclusively determine the activity of ERR.alpha.. Furthermore, we found that charcoal-dextran treatment of the serum did not affect the silencing activity of ERR.alpha. (FIG. 15A), supporting the notion that ERR.alpha. functions as a repressor independently of an exogenous ligand. One alternative possibility is that various cell types may or may not endogenously synthesize the putative ligand of ERR.alpha., thereby determining the transcriptional properties of ERR.alpha. in those cells. Second, the differences in transcriptional activity observed here might be a reflection of differences in the co-regulators present in these cell types. Third, by analogy with ER.alpha. (45-48), the phosphorylation state of ERR.alpha. may affect its functional activities. Indeed, Sladek et al. (26) showed that murine ERR.alpha. can be phosphorylated in vivo. Likewise, we have found that human ERR.alpha.1 can be phosphorylated in vitro by MAP kinase.

[0159] Model for ERR.alpha. Modulation of Estrogen Responsiveness: Based upon the data presented here, we postulate that ERR.alpha. plays key roles in the regulation of estrogen-responsive genes by efficiently binding EREs (Ref. 11; data not shown), leading either to modulation of the response to estrogens or functional substitution for ER.alpha. as a constitutive activator of ERE-dependent transcription. Furthermore, the cellular concentrations of ER.alpha. and ERR.alpha., together with the differential transcriptional properties of ERR.alpha., determine the transcriptional response of an ERE-regulated promoter. For example, when the concentrations of both ER.alpha. and ERR.alpha. are low or the level of the repressor form of ERR.alpha. is high, an ERE-dependent gene is expressed at intermediate or low levels (FIG. 20, rows 1 and 2, respectively). Low and high concentrations of the repressor form of ERR.alpha. relative to high amounts of active ER.alpha. complex yield intermediate or high ERE-dependent gene expression (FIG. 20, rows 3 and 4, respectively). Last, in the absence of active ER.alpha., the activator form of ERR.alpha. can constitutively activate ERE-dependent transcription (FIG. 20, rows 5 and 6).

[0160] Both estrogens acting through ERs and kinase signaling pathways contribute to the initiation and progression of some breast cancers. Because ERR.alpha. plays multiple roles in regulation of ERE-dependent transcription (FIG. 20), we hypothesis that the functionality of ERR.alpha., possibly modulated by kinase signaling events, leads to the development or progression of some breast cancers. We propose that the silencing activity of ERR.alpha. tightly regulates estrogen responsiveness in normal breast cells (FIG. 20, rows 1 and 2). Some cancerous cells attain very high levels of ER.alpha., thereby maximizing the mitogenic affects of estrogen (FIG. 20, rows 3 and 4). In addition, some breast cancers present as ER-negative (49-51) or develop resistance to hormonal treatment (52). Under either of these circumstances, ERR.alpha. may functionally substitute for ER.alpha. if it is in an active form, thereby constitutively activating ERE-regulated transcription (FIG. 20, rows 5 and 6). Thus, the conversion of ERR.alpha. from a repressor to an activator by a mechanism(s) yet to be determined may be a critical step in the progression to a hormone-independent phenotype.

References

[0161] 1. Evans, R. M. (1988) Science 240, 889-895.

[0162] 2. Beato, M. (1989) Cell 56, 335-344.

[0163] 3. Truss, M., and Beato, M. (1993) Endocr. Rev. 14, 459-479.

[0164] 4. Tsai, M. J., and O'Malley, B. W. (1994) Annu. Rev. Biochem. 63, 451-486.

[0165] 5. Mangelsdorf, D. J., Thummel, C., Beato, M., Herrlich, P., Schultz, G., Umesomo, K., Blumberg, B., Kastner, P., Mark, M., and Chambon, P. (1995) Cell 83, 835-839.

[0166] 6. Beato, M., Herrlich, P., and Schulz, G. (1995) Cell 83, 851-857.

[0167] 7. Enmark, E., and Gustafsson, J-. G. (1996) Mol. Endocrinol. 10, 1293-1307.

[0168] 8. Blumberg, B., and Evans, R. M. (1998) Genes Dev. 12, 3149-3155.

[0169] 9. Kliewer, S. A., Lehmann, J. M., and Willson, T. M. (1999) Science 284, 757-760.

[0170] 10. Gigure, V., Yang, N., Segui, P., and Evans, R. M. (1988) Nature 331, 91-94.

[0171] 11. Johnston, S. D., Liu, X., Zuo, F., Eisenbraun, T. L., Wiley, S. R., Kraus, R. J., and Mertz, J. E. (1997) Mol. Endocrinol. 11, 342-352.

[0172] 12. Shigeta, H., Zuo, W., Yang, N., DiAugustine, R., and Teng, C. T. (1997) J. Mol. Endocrinol. 19, 299-309.

[0173] 13. Chen, F., Zhang, Q., McDonald, T., Davidoff, M. J., Bailey, W., Bai, C., Liu, Q., and Caskey, C. T. (1999) Gene 228, 101-109.

[0174] 14. Hong, H., Yang, L., and Stallcup, M. R. (1999) J. Biol. Chem. 274, 22618-22626.

[0175] 15. Heard, D. J., Norby, P. L., Holloway, J., and Vissing, H. (2000) Mol. Endocrinol. 14, 382-392.

[0176] 16. Vanacker, J.-M., Pettersson, K., Gustafsson, J.-. G., and Laudet, V. (1999) EMBO J. 18, 4270-4279.

[0177] 17. Vanacker, J., M., Bonnelye, E., Chopin-Delannoy, S., Delmarre, C., Cavailles, V., and Laudet, V. (1999) Mol. Endocrinol. 13, 764-773.

[0178] 18. Yang, C., and Chen, S. (1999) Cancer Res. 59, 4519-4524.

[0179] 19. Xie, W., Hong, H., Yang, N. N., Lin, R. J., Simon, C. M., Stallcup, M. R., and Evans, R. M. (1999) Mol. Endocrinol. 13, 2151-2162.

[0180] 20. Zhang, Z., and Teng, C. T. (2000) J. Biol. Chem. 275, 20837-20846.

[0181] 21. Zhang, Z., and Teng, C. T. (2001) Mol. Cell. Endocrinol. 172, 223-233.

[0182] 22. Tremblay, G. B., Kunath, T., Bergeron, D., Lapointe, L., Champigny, L., Bader, J.-A., Rossant, J., and Gigure, V. (2001) Genes Dev. 15, 833-838.

[0183] 23. Lu, D., Kiriyama, Y., Lee, K. Y., and Gigure, V. (2001) Cancer Res. 61, 6755-6761.

[0184] 24. Coward, P., Lee, D., Hull, M. V., and Lehmann, J. M. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 8880-8884.

[0185] 25. Yang, N., Shigeta, H., Shi, H., and Teng, C. T. (1996) J. Biol. Chem. 271, 5795-5804.

[0186] 26. Sladek, R., Bader, J.-A., and Gigure, V. (1997) Mol. Cell. Biol. 17, 5400-5409.

[0187] 27. Bonnelye, E., Vanacker, J. M., Spruyt, N., Alric, S., Fournier, B., Desbiens, X., and Laudet, V. (1997) Mech. Dev. 65, 71-85.

[0188] 28. Bonnelye, E., Vanacker, J.-M., Dittmar, T., Begue, A., Desbiens, X., Denhardt, D. T., Aubin, J. E., Laudet, V., and Fournier, B. (1997) Mol. Endocrinol. 11, 905-916.

[0189] 29. Yang, C., Zhou, D., and Chen, S. (1998) Cancer Res. 58, 5695-5700.

[0190] 30. Vega, R. B, and Kelley, D. P. (1997) J. Biol. Chem. 272, 31693-31699.

[0191] 31. Vanacker, J.-M., Delmarre, C., Guo, X., and Laudet, V. (1998) Cell Growth Differ. 9, 1007-1014.

[0192] 32. Wiley, S. R., Kraus, R. J., Zuo, F., Murray, E. E., Loritz, K., and Mertz, J. E. (1993) Genes Dev. 7, 2206-2219.

[0193] 33. Catherino, W. H., and Jordan, V. C. (1995) Cancer Lett. 92, 39-47.

[0194] 34. Katzenellenbogen, J. A., Johnson, H. J., Jr., and Meyers, H. N. (1973) Biochemistry 12, 4085-4092.

[0195] 35. Kraus, R. J., Shadley, L., and Mertz, J. E. (2001) Virology 287, 89-104.

[0196] 36. Kraus, R. J., Mirocha, S. J., Stephany, H. M., Puchalski, J. R., and Mertz, J. E. (2001) J. Virol. 75, 867-877.

[0197] 37. Reese, J. C., and Katzenellenbogen, B. S. (1991) Nucleic Acids Res. 19, 6595-6602.

[0198] 38. Torchia, J., Glass, C., and Rosenfeld, M. G. (1998) Curr. Opin. Cell Biol. 10, 373-383.

[0199] 39. Perlmann, T., and Evans, R. M. (1997) Cell 90, 391-397.

[0200] 40. Horwitz, K. B., Jackson, T. A., Bain, D. L., Richer, J. K., Takimoto, G. S., and Tung, L. (1996) Mol. Endocrinol. 10, 1167-1177.

[0201] 41. Chen, J. D., and Li, H. (1998) Crit. Rev. Eukaryotic Gene Expression 8, 169-190

[0202] 42. Jenster, G. (1998) Mol. Cell. Endocrinol. 143, 1-7.

[0203] 43. Burbach, J. P. H., Lopes da Silva, S., Cox, J. J., Adan, R. A. H., Cooney, A. J., Tsai, M., and Tsai, S. Y. (1994) J. Biol. Chem. 269, 15046-15053.

[0204] 44. O'Reilley, G. H. (2000) Regulation of the SV40 Late Promoter by Nuclear Receptors and Large T Antigen,. Ph.D. thesis, University of Wisconsin-Madison

[0205] 45. Kato, S., Endoh, H., Masuhiro, Y., Kitamoto, T., Uchiyama, S., Sasaki, H., Masushige, S., Gotoh, Y., Nishida, E., Kawashima, H., Metzger, D., and Chambon, P. (1995) Science 270, 1491-1494.

[0206] 46. Bunone, G., Briand, P. A., Miksicek, R. J., and Picard, D. (1996) EMBO J. 15, 2174-2183.

[0207] 47. Joel, P. B., Smith, J., Sturgill, T. W., Fisher, T. L., Blenis, J., and Lannigan, D. A. (1998) Mol. Cell. Biol. 18, 1978-1984.

[0208] 48. Joel, P. B., Traish, A. M., and Lannigan, D. A. (1998) J. Biol. Chem. 273, 13317-13323.

[0209] 49. Knight, W. A., Livingston, R. B, Gregory, E. J., and McGuire, W. L. (1977) Cancer Res. 37, 4669-4671.

[0210] 50. Allegra, J. C., Lippman, M. E., Thompson, E. B., Simon, R., Barlock, A., Green, L., Huff, K. K., Do, H. M. T., Aitken, S. C., and Warren, R. (1980) Eur. J. Cancer 16, 323-331.

[0211] 51. Clark, G. M., and McGuire, W. L. (1983) Breast Cancer Res. Treat. Suppl: S3, 69-72

[0212] 52. Murphy, C. S., and Jordan, V. C. (1990) Receptor 1-2, 65-81.

EXAMPLE 3

Estrogen-related Receptor .alpha. and Estrogen-related Receptor .gamma. Associate with Unfavorable and Favorable Biomarkers, Respectively, in Human Breast Cancer

[0213] Abstract

[0214] The importance of estrogen-related receptors (ERRs) in human breast cancer was assessed by comparing their mRNA profiles with established clinicopathologic indicators and mRNA profiles of estrogen receptors (ERs) and ErbB family members. Using real-time quantitative polymerase chain reaction assays, mRNA levels of ER.alpha., ER.beta., EGFR (epidermal growth factor receptor), ErbB2, ErbB3, ErbB4, ERR.alpha., ERR.beta., and ERR.gamma. were determined in unselected primary breast tumors (n=38) and normal mammary epithelial cells (MECs) enriched from reduction mammoplasties (n=9). ERR.alpha. showed potential as a biomarker of unfavorable clinical outcome and, possibly, hormonal insensitivity. ERR.alpha. mRNA was expressed at levels greater than or equivalent to ER.alpha. mRNA in 24% of unselected breast tumors, and generally at higher levels than ER.alpha. in the PgR-negative tumor subgroup (1-way ANOVA with repeated measures, P=0.030). Increased ERR.alpha. levels associated with ER-negative (Fisher's exact, P=0.003) and PgR-negative tumor status (Fisher's exact, P=0.006; Kruskal-Wallis ANOVA, P=0.021). ERR.alpha. levels also correlated with expression of ErbB2 (Spearman's rho, P=0.005; cluster analysis), an indicator of aggressive tumor behavior. Thus, ERR.alpha. was the most abundant nuclear receptor in a subset of tumors that tended to lack functional ER.alpha. and expressed ErbB2 at high levels. Consequently, ERR.alpha. may potentiate constitutive transcription of estrogen response element-containing genes independently of ER.alpha. and antiestrogens in ErbB2-positive tumors. ERR.beta.'s potential as a biomarker remains unclear: it showed a direct relationship with ER.beta. (Spearman's rho, P=0.0002; cluster analysis) and inversely correlated with S-phase fraction (Spearman's rho, P=0.026). Unlike ERR.alpha., ERR.gamma. showed potential as a biomarker of favorable clinical course and, possibly, hormonal sensitivity. ERR.gamma. was overexpressed in 75% of the tumors, resulting in the median ERR.gamma. level being elevated in breast tumors compared to normal MECs (Kruskal-Wallis ANOVA, P=0.001). ERR.gamma. overexpression associated with the hormonally responsive phenotype, ER- and PgR-positive status (Fisher's exact, P=0.054 and P=0.045, respectively; cluster analysis). Additionally, ERR.gamma. expression correlated with levels of ErbB4 (Spearman's rho, P=0.052, cluster analysis), a likely indicator of preferred clinical course, and associated with diploid-typed tumors (Fisher's exact, P=0.042). Hence, determination of the status of ERR.alpha. and ERR.gamma. may be of significant benefit in the treatment of breast cancer, potentially by predicting the efficacy of hormonal and ErbB2-based therapies. Moreover, ERR.alpha. and ERR.gamma. are candidate targets for therapeutic development.

[0215] Introduction

[0216] Breast cancer afflicts one in eight women in the United States over their lifetime (1). ER.alpha. (NR3A1, (2)) mediates estrogen responsiveness (reviewed in (3)) and plays crucial roles in the etiology of breast cancer (reviewed in (4)). It has been developed into the single most important genetic biomarker and target for breast cancer therapy. ER.alpha. is present at detectable levels by ligand-binding and immunohistochemical assays in approximately 75% of clinical breast cancers. Selection of patients with ER.alpha.-positive breast tumors increases endocrine-based therapy response rates from about one-third in unselected patients to about one-half in patients with ER.alpha.-positive tumors (5). Since expression of PgR is dependent upon ER.alpha. activity, further selection of patients with ER.alpha.- and PgR-positive tumors enhances the breast cancer hormonal therapy response rate to nearly 80% (5). Although ER.beta. (NR3A2 (2)) also mediates responses to estrogens (reviewed in (3)), its roles in breast cancer are not as well understood. Reports have linked ER.beta. expression with low tumor aggressiveness (6) and higher levels of proliferation markers in the absence of ER.alpha. (7).

[0217] Members of the ErbB family of transmembrane tyrosine kinase receptors have been implicated in the pathogenesis of breast cancer. The members include EGFR (also HER1; ErbB1), ErbB2 (HER2; Neu), ErbB3 (HER3) and ErbB4 (HER4) (reviewed in (8)). ErbB members stimulate signal transduction pathways that involve MAPK. In response to initial binding of EGF-like peptide hormones, ErbB members form homodimers and heterodimers in various combinations to recruit distinct effector proteins [reviewed in (9)]. Although ErbB2 has not been demonstrated to interact directly with peptide hormones, it serves as a common regulatory heterodimer subunit with other ligand-bound ErbB members (reviewed in (10, 11)). Unlike the other ErbB members, ErbB3 lacks intrinsic kinase activity and, therefore, is required to heterodimerize with other ErbB members to participate in signaling (12).

[0218] Independent overexpression of either EGFR (reviewed in (13)) or ErbB2 (reviewed in (14)) associates with ER-negative tumor status, indicates aggressive tumor behavior, and predicts poor prognosis. Moreover, patients whose tumors coexpress both EGFR and ErbB2 exhibit a worse outcome than patients with tumors that overexpress only one of these genes (15, 16). Overexpression of ErbB2, most often due to gene amplification, occurs in approximately 15-30% of all breast cancers ((17), reviewed in (14)). Some (18-23), but not all reports (24, 25), have implicated ErbB2 in the development of resistance to antiestrogens.

[0219] ErbB2 has been targeted for development of the successful clinical agent Herceptin (trastuzumab), a recombinant humanized monoclonal antibody directed against this receptor's ectodomain (reviewed in (26)). Herceptin has been shown to be a suitable option as a first-line single-agent therapy (27), but will likely prove most beneficial as an adjuvant (28, 29). Clinical trials are currently underway to evaluate the combination of Herceptin with antiestrogens as a rational approach to treating ER.alpha.-positive/ErbB2-overexpressing tumors (23). In the near future, Herceptin will also likely be evaluated in combination with the small molecule EGFR tyrosine kinase inhibitor ZD1829 (Iressa), since this ATP-mimetic has been shown to almost completely block transphosphorylation of ErbB2 via heterodimerization with EGFR in intact cells (30) and inhibits the growth of breast cancer cell lines overexpressing both EGFR and ErbB2 (31). Hence, a combination of ZD1829 and Herceptin may be particularly beneficial to those patients whose tumors coexpress EGFR and ErbB2.

[0220] The ability of ErbB3 and ErbB4 to predict clinical course is not as clearly recognized as that of EGFR and ErbB2. ErbB3 has been observed at higher levels in breast tumors than normal tissues, showing associations with unfavorable prognostic indicators including ErbB2 expression (32), lymph node-positive status (33), and tumor size. However, it also associated with ER.alpha.-positive status, a favorable marker of hormonal sensitivity (34). In stark contrast to ErbB2, higher levels of ErbB4 have been associated with ER.alpha.-positive status (34, 35), more differentiated histotypes (36) and a more favorable outcome (16).

[0221] Despite the utility of ERs and ErbB members as indicators of clinical course, there remains a great need to identify additional breast cancer biomarkers. A family of potential candidate biomarkers includes the orphan nuclear receptors ERR.alpha. (37-39), ERR.beta. (37, 40), and ERR.gamma. (40-42) (NR3B1, NR3B2, and NR3B3, respectively (2)). These orphan receptors share significant amino acid sequence identity with ER.alpha. and ER.beta.. They also exhibit similar but distinct biochemical and transcriptional activities as the ERs. Each of the ERRs has been demonstrated to bind and activate transcription via consensus palindromic EREs (43-46) in addition to ERREs (39, 42, 44, 47-50), which are composed of an ERE half-site with a 5' extension of 3 base pairs. However, whereas ERs are ligand-activated transcription factors, the ERRs do not bind natural estrogens (37, 51). Instead, the ERRs may serve as constitutive regulators, interacting with transcriptional coactivators in vitro in the absence of ligands (45, 50, 52). Bulky amino acid side chains in the ligand binding pockets of ERRs substitute for the analogous ligand-induced interactions observed in ER.alpha. (52, 53). However, the ligand-binding pockets of the ERRs still allow binding of the synthetic estrogen diethylstilbestrol, but as an antagonist because it also disrupts coactivator interactions with ERRs (51). Similarly, the selective estrogen receptor modulator (SERM) 4-hydroxytamoxifen selectively antagonizes ERR.gamma. in cell-based assays (46, 52, 54).

Glypican-1 in human breast cancer
Compositions and methods for therapy and diagnosis of breast cancer
Mammaglobin, a mammary-specific breast cancer protein
Method of diagnosing breast cancer and compositions therefor
Use of anastrozole for the treatment of post-menopausal women having early breast cancer
Compositions and methods for the therapy and diagnosis of breast cancer
Treatment of breast cancer
Apparatus and method for breast cancer imaging


20040142361 Compositions and methods for the therapy and diagnosis of breast cancer
20040142328 Method and cloning vector for preparing multiple-gene diagnostic probes for the assessment of multiple markers for breast cancer prognosis
20040132118 Method of diagnosing breast cancer
20040101899 Compositions and methods for the therapy and diagnosis of breast cancer
20040097811 Apparatus and method for diagnosing breast-cancer including examination table
20040091423 Methods for identifying treating or monitoring asymptomatic patients for risk reduction or therapeutic treatment of breast cancer
20040087586 2-Heterosubstituted 3-aryl-4H-1-benzopyran-4-ones as novel therapeutics in breast cancer
20040086504 Cyr61 as a target for treatment and diagnosis of breast cancer
20040073016 Compositions and methods for the therapy and diagnosis of breast cancer
20030158166 Use of fulvestrant in the treatment of resistant breast cancer
20030157544 Novel methods of diagnosing breast cancer, compositions, and methods of screening for breast cancer modulators
20030152959 Method of using estrogen-related receptor alpha (ERRalpha) status to determine prognosis, treatment strategy and predisposition to breast cancer, and method of using ERRalpha as a therapeutic target for the treatment of breast cancer
20030152935 Proteins, genes and their use for diagnosis and treatment of breast cancer
20030149008 Hormonal implants treatment of the breast cancer
20030148364 Predisposition to breast cancer by mutations at the ataxia-telangiectasia genetic locus
20030144259 Breast cancer hormonal therapy
20030143546 Breast cancer transcription factor gene and uses
20030125640 Minimally invasive treatment for breast cancer
20030124543 Breast cancer marker
20030124128 Compositions, kits, and methods for identification, assessment, prevention, and therapy of breast cancer
20030108888 Breast cancer antigens
20030104418 Diagnostic markers for breast cancer
20030104366 Compositions for the treatment and diagnosis of breast cancer and methods for their use
20030103980 Glypican-1 in human breast cancer
20030099974 Novel genes, compositions, kits and methods for identification, assessment, prevention, and therapy of breast cancer

Copyright © 2006 - 2015 Patent Information Search